LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-Myc tag

Cat: HG11351-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LYAR/Ly1 antibody reactive Reagents
CRO Services
Product recommended

All LYAR/Ly1 antibody reactive Reagents
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Human Ly1 antibody reactive homolog (mouse) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-Myc tag Alternative Names
ZC2HC2 cDNA ORF Clone, Human;ZLYAR cDNA ORF Clone, Human
LYAR/Ly1 antibody reactive Background Information
Full Name
Ly1 antibody reactive

LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LYAR/Ly1 antibody reactive cDNA ORF Clone in Cloning Vector, Rhesus CG90626-G
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, untagged CG90626-UT
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90626-ACG
LYAR/Ly1 antibody reactive Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90626-ACGLN
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90626-ANG
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90626-ACR
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90626-ANR
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90626-CF
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90626-NF
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-His tag CG90626-CH
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-His tag CG90626-NH
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-HA tag CG90626-CY
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-HA tag CG90626-NY
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, C-Myc tag CG90626-CM
LYAR/Ly1 antibody reactive cDNA ORF Clone, Rhesus, N-Myc tag CG90626-NM

LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LYAR/Ly1 antibody reactive cDNA ORF Clone in Cloning Vector, Human HG11351-M
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, untagged HG11351-UT
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-GFPSpark® tag HG11351-ACG
LYAR/Ly1 antibody reactive Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11351-ACGLN
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-GFPSpark® tag HG11351-ANG
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-OFPSpark® tag HG11351-ACR
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-OFPSpark® tag HG11351-ANR
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11351-CF
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11351-NF
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-His tag HG11351-CH
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-His tag HG11351-NH
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, C-HA tag HG11351-CY
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-HA tag HG11351-NY
LYAR/Ly1 antibody reactive cDNA ORF Clone, Human, N-Myc tag HG11351-NM
LYAR/Ly1 antibody reactive qPCR Primer Pairs, Human HP101236
info info
添加购物车成功! 添加购物车失败!