MD2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10243-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MD2 Reagents
CRO Services
Product recommended

All MD2 Reagents
MD2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
483 bp
Description
Full length Clone DNA of Human lymphocyte antigen 96 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MD2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ESOP-1 cDNA ORF Clone, Human;ly-96 cDNA ORF Clone, Human;MD-2 cDNA ORF Clone, Human;MD2 cDNA ORF Clone, Human
MD2 Background Information

LY-96, also known as ESOP-1, is a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS). LY-96 also cooperates with TLR2 in the response to cell wall components from Gram-positive and Gram-negative bacteria. It enhances TLR4-dependent activation of NF-kappa-B. ESOP-1 has 160 amino acids, the sequence of which shows 64% identity with human ESOP-1/MD-2. ESOP-1 mRNA is highly expressed in the mouse embryos at 7.5 days after coitus.

Full Name
lymphocyte antigen 96
References
  • Shimazu R., et al.,(1999), MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J. Exp. Med. 189:1777-1782.
  • Kato K., et al., (2000), ESOP-1, a secreted protein expressed in the hematopoietic, nervous, and reproductive systems of embryonic and adult mice.Blood 96:362-364.
  • Schromm A.B., et al.,(2001), Molecular genetic analysis of an endotoxin nonresponder mutant cell line. A point mutation in a conserved region of MD-2 abolishes endotoxin-induced signaling.J. Exp. Med. 194:79-88.
  • MD2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MD2 cDNA ORF Clone in Cloning Vector, Mouse MG51098-G
    MD2 cDNA ORF Clone, Mouse, untagged MG51098-UT
    MD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51098-ACG
    MD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51098-ACGLN
    MD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51098-ACR
    MD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51098-CF
    MD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51098-NF
    MD2 cDNA ORF Clone, Mouse, C-His tag MG51098-CH
    MD2 cDNA ORF Clone, Mouse, N-His tag MG51098-NH
    MD2 cDNA ORF Clone, Mouse, C-HA tag MG51098-CY
    MD2 cDNA ORF Clone, Mouse, N-HA tag MG51098-NY
    MD2 cDNA ORF Clone, Mouse, C-Myc tag MG51098-CM
    MD2 cDNA ORF Clone, Mouse, N-Myc tag MG51098-NM
    MD2 qPCR Primer Pairs, Mouse MP201051

    MD2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MD2 cDNA ORF Clone in Cloning Vector, Human HG10243-M
    MD2 cDNA ORF Clone, Human, untagged HG10243-UT
    MD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10243-ACG
    MD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10243-ACGLN
    MD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10243-ACR
    MD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10243-CF
    MD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10243-NF
    MD2 cDNA ORF Clone, Human, C-His tag HG10243-CH
    MD2 cDNA ORF Clone, Human, N-His tag HG10243-NH
    MD2 cDNA ORF Clone, Human, C-HA tag HG10243-CY
    MD2 cDNA ORF Clone, Human, N-HA tag HG10243-NY
    MD2 cDNA ORF Clone, Human, C-Myc tag HG10243-CM
    MD2 qPCR Primer Pairs, Human HP100293
    info info
    添加购物车成功! 添加购物车失败!