Quick Order

Human MD1 / MMD-1 / LY86 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human LY86 cDNA Clone Product Information
NCBI RefSeq:NM_004271.3.
RefSeq ORF Size:489bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with N terminal His tag.
Gene Synonym:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

Size / Price
Catalog: HG10242-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"