Quick Order

Human MD1 / MMD-1 / LY86 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human LY86 cDNA Clone Product Information
    NCBI RefSeq:NM_004271.3.
    RefSeq ORF Size:489bp
    cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte antigen 86 with N terminal His tag.
    Gene Synonym:LY86, MD-1, MMD-1, dJ80N2.1, RP1-80N2.1
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LY86 qPCR primers for gene expression analysis, HP100292 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 105 (RP105) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP105 cell surface expression and function. It is indicated that the RP105/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 40% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.

    Size / Price
    Catalog: HG10242-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"