LTBR cDNA ORF Clone, Human, C-HA tag

Cat: HG10581-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LTBR Reagents
CRO Services
Product recommended

All LTBR Reagents
LTBR cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Human lymphotoxin beta receptor (TNFR superfamily, member 3) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LTBR cDNA ORF Clone, Human, C-HA tag Alternative Names
CD18 cDNA ORF Clone, Human;D12S370 cDNA ORF Clone, Human;LT-BETA-R cDNA ORF Clone, Human;TNF-R-III cDNA ORF Clone, Human;TNFCR cDNA ORF Clone, Human;TNFR-RP cDNA ORF Clone, Human;TNFR2-RP cDNA ORF Clone, Human;TNFR3 cDNA ORF Clone, Human;TNFRSF3 cDNA ORF Clone, Human
LTBR Background Information

LTBR (lymphotoxin beta receptor (TNFR superfamily, member 3)) is a member of the tumor necrosis factor (TNF) family of receptors. Tumor necrosis factor receptor is a trimeric cytokine receptor that binds tumor necrosis factors. The receptor cooperates with an adaptor protein (such as TRADD, TRAF, RIP), which is important in determining the outcome of the response. LTBR is expressed on the surface of most cell types, including cells of epithelial and myeloid lineages, but not on T and B lymphocytes. LTBR specifically binds the lymphotoxin membrane form (a complex of lymphotoxin-alpha and lymphtoxin-beta). LTBR and its ligand play a role in the development and organization of lymphoid tissue and tranformed cells. Activation of this protein can trigger apoptosis. Not only does the LTBR help trigger apoptosis, it can lead to the release of the cytokine interleukin 8. Overexpression of LTBR in HEK293 cells increases IL-8 promoter activity and leads to IL-8 release. It is also essential for development and organization of the secondary lymphoid organs and chemokine release.

Full Name
lymphotoxin beta receptor (TNFR superfamily, member 3)
References
  • Summers deLuca L, et al. (2011) A LTβR signaling in dendritic cells induces a type I IFN response that is required for optimal clonal expansion of CD8+ T cells. Proc Natl Acad Sci. 108(5):2046-51.
  • Bista P, et al. (2010) TRAF3 controls activation of the canonical and alternative NFkappaB by the lymphotoxin beta receptor. J Biol Chem. 285(17):12971-8.
  • Xu Y, et al. (2011) Adiponectin inhibits lymphotoxin-β receptor-mediated NF-κB signaling in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 404(4):1060-4.
  • LTBR cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LTBR cDNA ORF Clone in Cloning Vector, Rhesus CG90101-G
    LTBR cDNA ORF Clone, Rhesus, untagged CG90101-UT
    LTBR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90101-ACG
    LTBR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90101-ACGLN
    LTBR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90101-ACR
    LTBR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90101-CF
    LTBR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90101-NF
    LTBR cDNA ORF Clone, Rhesus, C-His tag CG90101-CH
    LTBR cDNA ORF Clone, Rhesus, N-His tag CG90101-NH
    LTBR cDNA ORF Clone, Rhesus, C-HA tag CG90101-CY
    LTBR cDNA ORF Clone, Rhesus, N-HA tag CG90101-NY
    LTBR cDNA ORF Clone, Rhesus, C-Myc tag CG90101-CM
    LTBR cDNA ORF Clone, Rhesus, N-Myc tag CG90101-NM

    LTBR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LTBR cDNA ORF Clone in Cloning Vector, Rat RG80178-G
    LTBR cDNA ORF Clone, Rat, untagged RG80178-UT
    LTBR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80178-ACG
    LTBR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80178-ACGLN
    LTBR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80178-ACR
    LTBR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80178-CF
    LTBR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80178-NF
    LTBR cDNA ORF Clone, Rat, C-His tag RG80178-CH
    LTBR cDNA ORF Clone, Rat, N-His tag RG80178-NH
    LTBR cDNA ORF Clone, Rat, C-HA tag RG80178-CY
    LTBR cDNA ORF Clone, Rat, N-HA tag RG80178-NY
    LTBR cDNA ORF Clone, Rat, C-Myc tag RG80178-CM
    LTBR cDNA ORF Clone, Rat, N-Myc tag RG80178-NM
    LTBR qPCR Primer Pairs, Rat RP300171

    LTBR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LTBR cDNA ORF Clone, Mouse, untagged MG57382-UT
    LTBR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57382-ACGLN
    LTBR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57382-ACG
    LTBR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57382-ACR
    LTBR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57382-CF
    LTBR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57382-NF
    LTBR cDNA ORF Clone, Mouse, C-His tag MG57382-CH
    LTBR cDNA ORF Clone, Mouse, N-His tag MG57382-NH
    LTBR cDNA ORF Clone, Mouse, C-HA tag MG57382-CY
    LTBR cDNA ORF Clone, Mouse, N-HA tag MG57382-NY
    LTBR cDNA ORF Clone, Mouse, C-Myc tag MG57382-CM
    LTBR cDNA ORF Clone, Mouse, N-Myc tag MG57382-NM

    LTBR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LTBR cDNA ORF Clone in Cloning Vector, Human HG10581-M
    LTBR cDNA ORF Clone, Human, untagged HG10581-UT
    LTBR cDNA ORF Clone, Human, C-GFPSpark® tag HG10581-ACG
    LTBR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10581-ACGLN
    LTBR cDNA ORF Clone, Human, C-OFPSpark® tag HG10581-ACR
    LTBR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10581-CF
    LTBR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10581-NF
    LTBR cDNA ORF Clone, Human, C-His tag HG10581-CH
    LTBR cDNA ORF Clone, Human, N-His tag HG10581-NH
    LTBR cDNA ORF Clone, Human, N-HA tag HG10581-NY
    LTBR cDNA ORF Clone, Human, C-Myc tag HG10581-CM
    LTBR cDNA ORF Clone, Human, N-Myc tag HG10581-NM
    LTBR qPCR Primer Pairs, Human HP100586
    info info
    添加购物车成功! 添加购物车失败!