Lymphotoxin Beta cDNA ORF Clone, Human, N-Myc tag

Cat: HG10850-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Lymphotoxin Beta Reagents
CRO Services
Product recommended

All Lymphotoxin Beta Reagents
Lymphotoxin Beta cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human lymphotoxin beta (TNF superfamily, member 3), transcript variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lymphotoxin Beta cDNA ORF Clone, Human, N-Myc tag Alternative Names
p33 cDNA ORF Clone, Human;TNFC cDNA ORF Clone, Human;TNFSF3 cDNA ORF Clone, Human
Lymphotoxin Beta Background Information
Full Name
lymphotoxin beta (TNF superfamily, member 3)

Lymphotoxin Beta cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Lymphotoxin Beta cDNA ORF Clone in Cloning Vector, Canine DG70067-G
Lymphotoxin Beta cDNA ORF Clone, Canine, untagged DG70067-UT
Lymphotoxin Beta Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70067-ACGLN
Lymphotoxin Beta cDNA ORF Clone, Canine, C-GFPSpark® tag DG70067-ACG
Lymphotoxin Beta cDNA ORF Clone, Canine, C-OFPSpark® tag DG70067-ACR
Lymphotoxin Beta cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70067-CF
Lymphotoxin Beta cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70067-NF
Lymphotoxin Beta cDNA ORF Clone, Canine, C-His tag DG70067-CH
Lymphotoxin Beta cDNA ORF Clone, Canine, N-His tag DG70067-NH
Lymphotoxin Beta cDNA ORF Clone, Canine, C-HA tag DG70067-CY
Lymphotoxin Beta cDNA ORF Clone, Canine, N-HA tag DG70067-NY
Lymphotoxin Beta cDNA ORF Clone, Canine, C-Myc tag DG70067-CM
Lymphotoxin Beta cDNA ORF Clone, Canine, N-Myc tag DG70067-NM

Lymphotoxin Beta cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Lymphotoxin Beta cDNA ORF Clone in Cloning Vector, Rhesus CG90092-G
Lymphotoxin Beta cDNA ORF Clone, Rhesus, untagged CG90092-UT
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90092-ACG
Lymphotoxin Beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90092-ACGLN
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90092-ACR
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90092-CF
Lymphotoxin Beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90092-NF
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-His tag CG90092-CH
Lymphotoxin Beta cDNA ORF Clone, Rhesus, N-His tag CG90092-NH
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-HA tag CG90092-CY
Lymphotoxin Beta cDNA ORF Clone, Rhesus, N-HA tag CG90092-NY
Lymphotoxin Beta cDNA ORF Clone, Rhesus, C-Myc tag CG90092-CM
Lymphotoxin Beta cDNA ORF Clone, Rhesus, N-Myc tag CG90092-NM

Lymphotoxin Beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Lymphotoxin Beta cDNA ORF Clone in Cloning Vector, Mouse MG50212-M
Lymphotoxin Beta cDNA ORF Clone, Mouse, untagged MG50212-UT
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50212-ACG
Lymphotoxin Beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50212-ACGLN
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50212-ACR
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50212-CF
Lymphotoxin Beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50212-NF
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-His tag MG50212-CH
Lymphotoxin Beta cDNA ORF Clone, Mouse, N-His tag MG50212-NH
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-HA tag MG50212-CY
Lymphotoxin Beta cDNA ORF Clone, Mouse, N-HA tag MG50212-NY
Lymphotoxin Beta cDNA ORF Clone, Mouse, C-Myc tag MG50212-CM
Lymphotoxin Beta cDNA ORF Clone, Mouse, N-Myc tag MG50212-NM
Lymphotoxin Beta qPCR Primer Pairs, Mouse MP200240

Lymphotoxin Beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Lymphotoxin Beta cDNA ORF Clone in Cloning Vector, Human HG10850-G
Lymphotoxin Beta cDNA ORF Clone in Cloning Vector, Human HG13661-G
Lymphotoxin Beta cDNA ORF Clone, Human, untagged HG13661-UT
Lymphotoxin Beta cDNA ORF Clone, Human, untagged HG10850-UT
Lymphotoxin Beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13661-ACGLN
Lymphotoxin Beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10850-ACGLN
Lymphotoxin Beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10850-ACG
Lymphotoxin Beta cDNA ORF Clone, Human, C-GFPSpark® tag HG13661-ACG
Lymphotoxin Beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10850-ACR
Lymphotoxin Beta cDNA ORF Clone, Human, C-OFPSpark® tag HG13661-ACR
Lymphotoxin Beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10850-CF
Lymphotoxin Beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13661-CF
Lymphotoxin Beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10850-NF
Lymphotoxin Beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13661-NF
Lymphotoxin Beta cDNA ORF Clone, Human, C-His tag HG13661-CH
Lymphotoxin Beta cDNA ORF Clone, Human, C-His tag HG10850-CH
Lymphotoxin Beta cDNA ORF Clone, Human, N-His tag HG10850-NH
Lymphotoxin Beta cDNA ORF Clone, Human, N-His tag HG13661-NH
Lymphotoxin Beta cDNA ORF Clone, Human, C-HA tag HG10850-CY
Lymphotoxin Beta cDNA ORF Clone, Human, C-HA tag HG13661-CY
Lymphotoxin Beta cDNA ORF Clone, Human, N-HA tag HG13661-NY
Lymphotoxin Beta cDNA ORF Clone, Human, N-HA tag HG10850-NY
Lymphotoxin Beta cDNA ORF Clone, Human, C-Myc tag HG13661-CM
Lymphotoxin Beta cDNA ORF Clone, Human, C-Myc tag HG10850-CM
Lymphotoxin Beta cDNA ORF Clone, Human, N-Myc tag HG13661-NM
Lymphotoxin Beta qPCR Primer Pairs, Human HP100747
info info
添加购物车成功! 添加购物车失败!