TNF beta cDNA ORF Clone, Human, N-His tag

Cat: HG10270-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TNF beta Reagents
CRO Services
Product recommended

All TNF beta Reagents
TNF beta cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Human lymphotoxin alpha (TNF superfamily, member 1) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TNF beta cDNA ORF Clone, Human, N-His tag Alternative Names
LT cDNA ORF Clone, Human;TNFB cDNA ORF Clone, Human;TNFSF1 cDNA ORF Clone, Human
TNF beta Background Information

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

Full Name
lymphotoxin alpha
References
  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • TNF beta cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    TNF beta cDNA ORF Clone in Cloning Vector, Canine DG70066-G
    TNF beta cDNA ORF Clone, Canine, untagged DG70066-UT
    TNF beta cDNA ORF Clone, Canine, C-GFPSpark® tag DG70066-ACG
    TNF beta Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70066-ACGLN
    TNF beta cDNA ORF Clone, Canine, C-OFPSpark® tag DG70066-ACR
    TNF beta cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70066-CF
    TNF beta cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70066-NF
    TNF beta cDNA ORF Clone, Canine, C-His tag DG70066-CH
    TNF beta cDNA ORF Clone, Canine, N-His tag DG70066-NH
    TNF beta cDNA ORF Clone, Canine, C-HA tag DG70066-CY
    TNF beta cDNA ORF Clone, Canine, N-HA tag DG70066-NY
    TNF beta cDNA ORF Clone, Canine, C-Myc tag DG70066-CM
    TNF beta cDNA ORF Clone, Canine, N-Myc tag DG70066-NM

    TNF beta cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TNF beta cDNA ORF Clone in Cloning Vector, Rhesus CG90086-G
    TNF beta cDNA ORF Clone, Rhesus, untagged CG90086-UT
    TNF beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90086-ACG
    TNF beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90086-ACGLN
    TNF beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90086-ACR
    TNF beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90086-CF
    TNF beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90086-NF
    TNF beta cDNA ORF Clone, Rhesus, C-His tag CG90086-CH
    TNF beta cDNA ORF Clone, Rhesus, N-His tag CG90086-NH
    TNF beta cDNA ORF Clone, Rhesus, C-HA tag CG90086-CY
    TNF beta cDNA ORF Clone, Rhesus, N-HA tag CG90086-NY
    TNF beta cDNA ORF Clone, Rhesus, C-Myc tag CG90086-CM
    TNF beta cDNA ORF Clone, Rhesus, N-Myc tag CG90086-NM

    TNF beta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TNF beta cDNA ORF Clone in Cloning Vector, Rat RG80147-G
    TNF beta cDNA ORF Clone, Rat, untagged RG80147-UT
    TNF beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80147-ACGLN
    TNF beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80147-ACG
    TNF beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80147-ACR
    TNF beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80147-CF
    TNF beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80147-NF
    TNF beta cDNA ORF Clone, Rat, C-His tag RG80147-CH
    TNF beta cDNA ORF Clone, Rat, N-His tag RG80147-NH
    TNF beta cDNA ORF Clone, Rat, C-HA tag RG80147-CY
    TNF beta cDNA ORF Clone, Rat, N-HA tag RG80147-NY
    TNF beta cDNA ORF Clone, Rat, C-Myc tag RG80147-CM
    TNF beta cDNA ORF Clone, Rat, N-Myc tag RG80147-NM
    TNF beta qPCR Primer Pairs, Rat RP300142

    TNF beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TNF beta cDNA ORF Clone in Cloning Vector, Mouse MG50682-M
    TNF beta cDNA ORF Clone, Mouse, untagged MG50682-UT
    TNF beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50682-ACG
    TNF beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50682-ACGLN
    TNF beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50682-ACR
    TNF beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50682-CF
    TNF beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50682-NF
    TNF beta cDNA ORF Clone, Mouse, C-His tag MG50682-CH
    TNF beta cDNA ORF Clone, Mouse, N-His tag MG50682-NH
    TNF beta cDNA ORF Clone, Mouse, C-HA tag MG50682-CY
    TNF beta cDNA ORF Clone, Mouse, N-HA tag MG50682-NY
    TNF beta cDNA ORF Clone, Mouse, C-Myc tag MG50682-CM
    TNF beta cDNA ORF Clone, Mouse, N-Myc tag MG50682-NM
    TNF beta qPCR Primer Pairs, Mouse MP200660

    TNF beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TNF beta cDNA ORF Clone in Cloning Vector, Human HG10270-M
    TNF beta cDNA ORF Clone, Human, untagged HG10270-UT
    TNF beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10270-ACG
    TNF beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10270-ACGLN
    TNF beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10270-ACR
    TNF beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10270-CF
    TNF beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10270-NF
    TNF beta cDNA ORF Clone, Human, C-His tag HG10270-CH
    TNF beta cDNA ORF Clone, Human, C-HA tag HG10270-CY
    TNF beta cDNA ORF Clone, Human, N-HA tag HG10270-NY
    TNF beta cDNA ORF Clone, Human, C-Myc tag HG10270-CM
    TNF beta cDNA ORF Clone, Human, N-Myc tag HG10270-NM
    TNF beta qPCR Primer Pairs, Human HP100318
    info info
    添加购物车成功! 添加购物车失败!