After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LTA / TNFB ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human LTA cDNA Clone Product Information
NCBI RefSeq:NM_000595.2
RefSeq ORF Size:603bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphotoxin alpha (TNF superfamily, member 1) with N terminal Myc tag.
Gene Synonym:LT, TNFB, TNFSF1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

References
  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Size / Price
    Catalog: HG10270-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"