Quick Order

Text Size:AAA

Human LSM1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human LSM1 cDNA Clone Product Information
NCBI RefSeq:BC001767
RefSeq ORF Size:402bp
cDNA Description:Full length Clone DNA of Homo sapiens LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) with C terminal His tag.
Gene Synonym:CASM, YJL124C, LSM1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

LSM1 is a Sm-like protein. Sm-like proteins can be detected in a variety of organisms based on sequence homology with the Sm protein family. Sm-like proteins include the Sm sequence motif, which consists of two regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. LSM1 has a role in replication-dependent histone mRNA degradation and binds specifically to the 3''-terminal U-tract of U6 snRNA. LSM1 also facilitates RNA protein interactions and structural modifications which are required during ribosomal subunit assembly.

References
  • Shimizu Y, et al. (1997) Lineage- and differentiation stage-specific expression of LSM-1 (LPAP), a possible substrate for CD45, in human hematopoietic cells. Am J Hematol. 54(1):1=11.
  • Graber MW, et al. (1997) CaSm: an Sm-like protein that contributes to the transformed state in cancer cells. Cancer Res. 57(14):2961-5.
  • Séraphin B, et al. (1999) Sm and Sm-like proteins assemble in two related complexes of deep evolutionary origin. EMBO J. 18(12):3451-62.
  • Size / Price
    Catalog: HG14142-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"