After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LSAMP Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human LSAMP cDNA Clone Product Information
NCBI RefSeq:BC033803
RefSeq ORF Size:1017bp
cDNA Description:Full length Clone DNA of Homo sapiens limbic system-associated membrane protein with N terminal Flag tag.
Gene Synonym:LAMP, IGLON3, FLJ34254, FLJ35396, FLJ37216, FLJ54658, LSAMP
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

The limbic system-associated membrane protein (LAMP) is a cell surface glycoprotein expressed by cortical and subcortical regions of the mammalian CNS that comprise or receive direct projections from limbic system structures. The 64-68-kDa glycoprotein limbic system-associated membrane protein (LsAMP) is expressed on the surface of somata and proximal dendrites of neurons. These areas perform cognitive and autonomic functions, also learning and memory. The functional analysis indicates that LsAMP acts as a selective adhesion molecule, serving as a guidance cue for specific patterns of connectivity, which underlies the normal development of the limbic system. In animal studies there have been found that rats with increased level of anxiety had 1.6-fold higher expression of LsAMP gene in the periaqueductal gray compared to rats with low level of anxiety, indicating a possible role of LsAMP in the regulation of anxiety.

References
  • Zacco A. et al., 1990, The Journal of Neuroscience. 10(1): 73-90.
  • Pimenta AF. et al., 1996, Gene. 170(2) :189-95.
  • Size / Price
    Catalog: HG12136-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"