LRWD1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14945-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LRWD1 Reagents
CRO Services
Product recommended

All LRWD1 Reagents
LRWD1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1944 bp
Description
Full length Clone DNA of Human leucine-rich repeats and WD repeat domain containing 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRWD1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CENP-33 cDNA ORF Clone, Human;ORCA cDNA ORF Clone, Human
LRWD1 Background Information
Full Name
leucine-rich repeats and WD repeat domain containing 1

LRWD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LRWD1 cDNA ORF Clone in Cloning Vector, Mouse MG51104-G
LRWD1 cDNA ORF Clone, Mouse, untagged MG51104-UT
LRWD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51104-ACG
LRWD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51104-ACGLN
LRWD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51104-ANG
LRWD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51104-ACR
LRWD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51104-ANR
LRWD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51104-CF
LRWD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51104-NF
LRWD1 cDNA ORF Clone, Mouse, C-His tag MG51104-CH
LRWD1 cDNA ORF Clone, Mouse, N-His tag MG51104-NH
LRWD1 cDNA ORF Clone, Mouse, C-HA tag MG51104-CY
LRWD1 cDNA ORF Clone, Mouse, N-HA tag MG51104-NY
LRWD1 cDNA ORF Clone, Mouse, C-Myc tag MG51104-CM
LRWD1 cDNA ORF Clone, Mouse, N-Myc tag MG51104-NM
LRWD1 qPCR Primer Pairs, Mouse MP201057

LRWD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LRWD1 cDNA ORF Clone in Cloning Vector, Human HG14945-G
LRWD1 cDNA ORF Clone, Human, untagged HG14945-UT
LRWD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14945-ACG
LRWD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14945-ACGLN
LRWD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14945-ANG
LRWD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14945-ACR
LRWD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14945-ANR
LRWD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14945-CF
LRWD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14945-NF
LRWD1 cDNA ORF Clone, Human, C-His tag HG14945-CH
LRWD1 cDNA ORF Clone, Human, N-His tag HG14945-NH
LRWD1 cDNA ORF Clone, Human, C-HA tag HG14945-CY
LRWD1 cDNA ORF Clone, Human, N-HA tag HG14945-NY
LRWD1 cDNA ORF Clone, Human, C-Myc tag HG14945-CM
LRWD1 qPCR Primer Pairs, Human HP103574
info info
添加购物车成功! 添加购物车失败!