LRRN3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11610-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LRRN3 Reagents
CRO Services
Product recommended

All LRRN3 Reagents
LRRN3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2127 bp
Description
Full length Clone DNA of Human leucine rich repeat neuronal 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRRN3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
FIGLER5 cDNA ORF Clone, Human;NLRR-3 cDNA ORF Clone, Human;NLRR3 cDNA ORF Clone, Human
LRRN3 Background Information

Leucine-rich repeat neuronal protein 3, also known as neuronal leucine-rich repeat protein 3 (NLRR-3), is a member of leucine-rich (LRR) family whose members have significant functions in neural development. Leucine-rich repeats are short sequence motifs present in a number of proteins with diverse functions and cellular locations. All proteins containing these repeats are thought to be involved in protein-protein interactions. The crystal structure of ribonuclease inhibitor protein has revealed that leucine-rich repeats correspond to β-α structural units. These units are arranged so that they form a parallel β-sheet with one surface exposed to solvent, so that the protein acquires an unusual, non-globular shape. These two features may be responsible for the protein-binding functions of proteins containing leucine-rich repeats. LRRN3 plays an important role in cerebellum postnatal development. In a unilateral cortical injury cerebral cortex, NLRR-3 mRNA increased in layers 2-3 which suggests that NLRR-3 may be an important component of the pathophysiological response to brain injury. 

Full Name
leucine rich repeat neuronal 3
References
  • Yang J, et al. (2011) Role of LRRN3 in the cerebellum postnatal development in rats. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 36 (5): 424-9.
  • Hutcheson HB, et al. (2004) Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med Genet. 5: 12.
  • Ishii N, et al. (1996) Increased expression of NLRR-3 mRNA after cortical brain injury in mouse. Brain Res Mol Brain Res. 40 (1): 148-52.
  • info info
    添加购物车成功! 添加购物车失败!