After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LRG1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LRG1 cDNA Clone Product Information
NCBI RefSeq:BC034389
RefSeq ORF Size:1044bp
cDNA Description:Full length Clone DNA of Homo sapiens leucine-rich alpha-2-glycoprotein 1.
Gene Synonym:LRG, HMFT1766, LRG1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

LRG1 belongs to the leucine-rich repeat (LRR) family. Members of this family are involved in protein-protein interaction, signal transduction, and cell adhesion and development. LRG1 is expressed during granulocyte differentiation. It contains 4 LIM zinc-binding domains and 1 Rho-GAP domain.

References
  • O Donnell LC. et al., 2002, J Leukoc Biol. 72 (3): 478-85.
  • Li X. et al., 2007, Neurosci Lett. 413 (2): 141-4.
  • Ramachandran P. et al., 2006, J Proteome Res. 5 (6): 1493-503.
  • Size / Price
    Catalog: HG13371-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"