ERAP2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10734-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ERAP2 Reagents
CRO Services
Product recommended

All ERAP2 Reagents
ERAP2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2883 bp
Description
Full length Clone DNA of Human endoplasmic reticulum aminopeptidase 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERAP2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
FLJ23633 cDNA ORF Clone, Human;FLJ23701 cDNA ORF Clone, Human;FLJ23807 cDNA ORF Clone, Human;L-RAP cDNA ORF Clone, Human;LRAP cDNA ORF Clone, Human;LRAP.ERAP2 cDNA ORF Clone, Human
ERAP2 Background Information

Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in the in the lumenal side of endoplasmic reticulum (ER) processing antigenic peptides presented to major histocompatibility complex (MHC) class I molecules. It is a 960-amino acid protein with significant homology to placental leucine aminopeptidase and adipocyte-derived leucine aminopeptidase. LRAP preferentially hydrolyzes the basic residues Arg and Lys, and contains the HEXXH(X)18E zinc-binding motif, which is the characteristic of the M1 family of zinc metallopeptidases which also includes PILS/ARTS1/ERAP1 and LNPEP/PLAP. Induced by interferon-gamma, LRAP is able to trim various MHC class I antigenic peptide precursors.

Full Name
endoplasmic reticulum aminopeptidase 2
References
  • Tanioka T., et al.,(2003), Human leukocyte-derived arginine aminopeptidase. The third member of the oxytocinase subfamily of aminopeptidases. J. Biol. Chem. 278:32275-32283.
  • Tanioka T., et al., (2005), Regulation of the human leukocyte-derived arginine aminopeptidase/endoplasmic reticulum-aminopeptidase 2 gene by interferon-gamma.FEBS J. 272:916-928.
  • Liu T., et al.,(2005), Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry.J. Proteome Res. 4:2070-2080.
  • info info
    添加购物车成功! 添加购物车失败!