Quick Order

Text Size:AAA

Human ERAP2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ERAP2 cDNA Clone Product Information
NCBI RefSeq:NM_022350.3
RefSeq ORF Size:2883bp
cDNA Description:Full length Clone DNA of Homo sapiens endoplasmic reticulum aminopeptidase 2.
Gene Synonym:LRAP, L-RAP, FLJ23633, FLJ23701, FLJ23807, ERAP2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in the in the lumenal side of endoplasmic reticulum (ER) processing antigenic peptides presented to major histocompatibility complex (MHC) class I molecules. It is a 960-amino acid protein with significant homology to placental leucine aminopeptidase and adipocyte-derived leucine aminopeptidase. LRAP preferentially hydrolyzes the basic residues Arg and Lys, and contains the HEXXH(X)18E zinc-binding motif, which is the characteristic of the M1 family of zinc metallopeptidases which also includes PILS/ARTS1/ERAP1 and LNPEP/PLAP. Induced by interferon-gamma, LRAP is able to trim various MHC class I antigenic peptide precursors.

Size / Price
Catalog: HG10734-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"