After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ERAP2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human ERAP2 cDNA Clone Product Information
NCBI RefSeq:NM_022350.3
RefSeq ORF Size:2883bp
cDNA Description:Full length Clone DNA of Homo sapiens endoplasmic reticulum aminopeptidase 2 with C terminal Myc tag.
Gene Synonym:LRAP, L-RAP, FLJ23633, FLJ23701, FLJ23807, ERAP2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Leukocyte-derived arginine aminopeptidase (LRAP), also known as endoplasmic reticulum-aminopeptidase 2 (ERAP2), is the second identified aminopeptidase localized in the in the lumenal side of endoplasmic reticulum (ER) processing antigenic peptides presented to major histocompatibility complex (MHC) class I molecules. It is a 960-amino acid protein with significant homology to placental leucine aminopeptidase and adipocyte-derived leucine aminopeptidase. LRAP preferentially hydrolyzes the basic residues Arg and Lys, and contains the HEXXH(X)18E zinc-binding motif, which is the characteristic of the M1 family of zinc metallopeptidases which also includes PILS/ARTS1/ERAP1 and LNPEP/PLAP. Induced by interferon-gamma, LRAP is able to trim various MHC class I antigenic peptide precursors.

Size / Price
Catalog: HG10734-CM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"