LPL cDNA ORF Clone, Human, C-His tag

Cat: HG12079-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LPL Reagents
CRO Services
Product recommended

All LPL Reagents
LPL cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1473 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1164C/A not causing the amino acid variation.
Description
Full length Clone DNA of Human lipoprotein lipase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+1.47kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LPL cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LPL cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
LPL cDNA ORF Clone, Human, C-His tag Alternative Names
HDLCQ11 cDNA ORF Clone, Human;LIPD cDNA ORF Clone, Human
LPL Background Information
Full Name
lipoprotein lipase

LPL cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LPL cDNA ORF Clone in Cloning Vector, Rat RG81993-U
LPL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81993-ACGLN

LPL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LPL cDNA ORF Clone in Cloning Vector, Mouse MG51607-U
LPL cDNA ORF Clone, Mouse, untagged MG51607-UT
LPL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51607-ACG
LPL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51607-ACGLN
LPL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51607-ACR
LPL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51607-CF
LPL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51607-NF
LPL cDNA ORF Clone, Mouse, C-His tag MG51607-CH
LPL cDNA ORF Clone, Mouse, N-His tag MG51607-NH
LPL cDNA ORF Clone, Mouse, C-HA tag MG51607-CY
LPL cDNA ORF Clone, Mouse, N-HA tag MG51607-NY
LPL cDNA ORF Clone, Mouse, C-Myc tag MG51607-CM
LPL cDNA ORF Clone, Mouse, N-Myc tag MG51607-NM
LPL qPCR Primer Pairs, Mouse MP201274

LPL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LPL cDNA ORF Clone in Cloning Vector, Human HG12079-G
LPL cDNA ORF Clone, Human, untagged HG12079-UT
LPL cDNA ORF Clone, Human, C-GFPSpark® tag HG12079-ACG
LPL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12079-ACGLN
LPL cDNA ORF Clone, Human, C-OFPSpark® tag HG12079-ACR
LPL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12079-CF
LPL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12079-NF
LPL cDNA ORF Clone, Human, N-His tag HG12079-NH
LPL cDNA ORF Clone, Human, C-HA tag HG12079-CY
LPL cDNA ORF Clone, Human, N-HA tag HG12079-NY
LPL cDNA ORF Clone, Human, C-Myc tag HG12079-CM
LPL cDNA ORF Clone, Human, N-Myc tag HG12079-NM
LPL qPCR Primer Pairs, Human HP101607
info info
添加购物车成功! 添加购物车失败!