LOXL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11664-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LOXL2 Reagents
CRO Services
Product recommended

All LOXL2 Reagents
LOXL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2325 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1038 A>G not causing the amino acid variation.
Description
Full length Clone DNA of Human lysyl oxidase-like 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.36kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LOXL2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LOXL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human LOXL2/Lysyl oxidase-like 2 Gene Expression validated Image 14150
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
LOXL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
LOR2 cDNA ORF Clone, Human;Lysyl oxidase-like 2 cDNA ORF Clone, Human;WS9-14 cDNA ORF Clone, Human
LOXL2 Background Information

Lysyl oxidase homolog 2, also known as Lysyl oxidase-like protein 2, Lysyl oxidase-related protein 2, Lysyl oxidase-related protein WS9-14 and LOXL2, is a secreted protein which belongs to the lysyl oxidase family. LOXL2 contains four SRCR domains. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 ( LOXL1, LOXL2, LOXL3, LOXL4 ). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. LOXL2 expression could also be explored as a molecular target in the prevention of breast cancer progression.

Full Name
lysyl oxidase-like 2
References
  • Peng,L. et al., 2009, Carcinogenesis. 30 (10):1660-9.
  • Hollosi,P. et al., 2009, Int J Cancer. 125 (2):318-27.
  • Rückert,F. et al., 2010, Int J Colorectal Dis. 25 (3):303-11.
  • Iftikhar,M. et al., 2011, J Biol Chem. 286 (2):909-18.
  • info info
    添加购物车成功! 添加购物车失败!