LMAN1 cDNA ORF Clone, Human, untagged

Cat: HG16166-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LMAN1 Reagents
CRO Services
Product recommended

All LMAN1 Reagents
LMAN1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1533 bp
Description
Full length Clone DNA of Human lectin, mannose-binding, 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMAN1 cDNA ORF Clone, Human, untagged Alternative Names
ERGIC-53 cDNA ORF Clone, Human;ERGIC53 cDNA ORF Clone, Human;F5F8D cDNA ORF Clone, Human;FMFD1 cDNA ORF Clone, Human;gp58 cDNA ORF Clone, Human;MCFD1 cDNA ORF Clone, Human;MR60 cDNA ORF Clone, Human
LMAN1 Background Information
Full Name
lectin, mannose-binding, 1

LMAN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LMAN1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0204-U
LMAN1 cDNA ORF Clone, Mouse, untagged MG5A0204-UT
LMAN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0204-ACG
LMAN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0204-ACGLN
LMAN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0204-ACR
LMAN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0204-CF
LMAN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0204-NF
LMAN1 cDNA ORF Clone, Mouse, C-His tag MG5A0204-CH
LMAN1 cDNA ORF Clone, Mouse, N-His tag MG5A0204-NH
LMAN1 cDNA ORF Clone, Mouse, C-HA tag MG5A0204-CY
LMAN1 cDNA ORF Clone, Mouse, N-HA tag MG5A0204-NY
LMAN1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0204-CM
LMAN1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0204-NM

LMAN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LMAN1 cDNA ORF Clone in Cloning Vector, Human HG16166-U
LMAN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16166-ACGLN
LMAN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16166-ACG
LMAN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16166-ACR
LMAN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16166-CF
LMAN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16166-NF
LMAN1 cDNA ORF Clone, Human, C-His tag HG16166-CH
LMAN1 cDNA ORF Clone, Human, N-His tag HG16166-NH
LMAN1 cDNA ORF Clone, Human, C-HA tag HG16166-CY
LMAN1 cDNA ORF Clone, Human, N-HA tag HG16166-NY
LMAN1 cDNA ORF Clone, Human, C-Myc tag HG16166-CM
LMAN1 cDNA ORF Clone, Human, N-Myc tag HG16166-NM
LMAN1 qPCR Primer Pairs, Human HP104935
info info
添加购物车成功! 添加购物车失败!