LITAF cDNA ORF Clone, Human, N-Myc tag

Cat: HG13875-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LITAF Reagents
CRO Services
Product recommended

All LITAF Reagents
LITAF cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Human lipopolysaccharide-induced TNF factor with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LITAF cDNA ORF Clone, Human, N-Myc tag Alternative Names
PIG7 cDNA ORF Clone, Human;SIMPLE cDNA ORF Clone, Human;TP53I7 cDNA ORF Clone, Human
LITAF Background Information
Full Name
lipopolysaccharide-induced TNF factor

LITAF cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LITAF cDNA ORF Clone in Cloning Vector, Rat RG84543-U
LITAF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84543-ACGLN

LITAF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LITAF cDNA ORF Clone in Cloning Vector, Mouse MG59585-U
LITAF cDNA ORF Clone, Mouse, untagged MG59585-UT
LITAF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59585-ACG
LITAF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59585-ACGLN
LITAF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59585-ACR
LITAF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59585-CF
LITAF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59585-NF
LITAF cDNA ORF Clone, Mouse, C-His tag MG59585-CH
LITAF cDNA ORF Clone, Mouse, N-His tag MG59585-NH
LITAF cDNA ORF Clone, Mouse, C-HA tag MG59585-CY
LITAF cDNA ORF Clone, Mouse, N-HA tag MG59585-NY
LITAF cDNA ORF Clone, Mouse, C-Myc tag MG59585-CM
LITAF cDNA ORF Clone, Mouse, N-Myc tag MG59585-NM

LITAF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LITAF cDNA ORF Clone in Cloning Vector, Human HG13875-G
LITAF cDNA ORF Clone, Human, untagged HG13875-UT
LITAF cDNA ORF Clone, Human, C-GFPSpark® tag HG13875-ACG
LITAF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13875-ACGLN
LITAF cDNA ORF Clone, Human, C-OFPSpark® tag HG13875-ACR
LITAF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13875-CF
LITAF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13875-NF
LITAF cDNA ORF Clone, Human, C-His tag HG13875-CH
LITAF cDNA ORF Clone, Human, N-His tag HG13875-NH
LITAF cDNA ORF Clone, Human, C-HA tag HG13875-CY
LITAF cDNA ORF Clone, Human, N-HA tag HG13875-NY
LITAF cDNA ORF Clone, Human, C-Myc tag HG13875-CM
LITAF qPCR Primer Pairs, Human HP102546
info info
添加购物车成功! 添加购物车失败!