LIMK2 cDNA ORF Clone, Human, untagged

Cat: HG10720-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LIMK2 Reagents
CRO Services
Product recommended

All LIMK2 Reagents
LIMK2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1917 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 1209C/G not causing the amino acid variation.
Description
Full length Clone DNA of Human LIM domain kinase 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 1.92kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LIMK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIMK2 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
LIMK2 Background Information
Full Name
LIM domain kinase 2

LIMK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LIMK2 cDNA ORF Clone in Cloning Vector, Mouse MG51034-G
LIMK2 cDNA ORF Clone, Mouse, untagged MG51034-UT
LIMK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51034-ACGLN
LIMK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51034-ACG
LIMK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51034-ANG
LIMK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51034-ACR
LIMK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51034-ANR
LIMK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51034-CF
LIMK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51034-NF
LIMK2 cDNA ORF Clone, Mouse, C-His tag MG51034-CH
LIMK2 cDNA ORF Clone, Mouse, N-His tag MG51034-NH
LIMK2 cDNA ORF Clone, Mouse, C-HA tag MG51034-CY
LIMK2 cDNA ORF Clone, Mouse, N-HA tag MG51034-NY
LIMK2 cDNA ORF Clone, Mouse, C-Myc tag MG51034-CM
LIMK2 cDNA ORF Clone, Mouse, N-Myc tag MG51034-NM
LIMK2 qPCR Primer Pairs, Mouse MP200993

LIMK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LIMK2 cDNA ORF Clone in Cloning Vector, Human HG10720-M
LIMK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10720-ACGLN
LIMK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10720-ACG
LIMK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10720-ANG
LIMK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10720-ACR
LIMK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10720-ANR
LIMK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10720-CF
LIMK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10720-NF
LIMK2 cDNA ORF Clone, Human, C-His tag HG10720-CH
LIMK2 cDNA ORF Clone, Human, N-His tag HG10720-NH
LIMK2 cDNA ORF Clone, Human, C-HA tag HG10720-CY
LIMK2 cDNA ORF Clone, Human, N-HA tag HG10720-NY
LIMK2 cDNA ORF Clone, Human, C-Myc tag HG10720-CM
LIMK2 cDNA ORF Clone, Human, N-Myc tag HG10720-NM
LIMK2 qPCR Primer Pairs, Human HP100889
info info
添加购物车成功! 添加购物车失败!