LILRA4 / CD85g cDNA ORF Clone, Human, N-His tag

Cat: HG16058-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LILRA4 / CD85g Reagents
CRO Services
Product recommended

All LILRA4 / CD85g Reagents
LILRA4 / CD85g cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1500 bp
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LILRA4 / CD85g cDNA ORF Clone, Human, N-His tag Alternative Names
CD85g cDNA ORF Clone, Human;ILT7 cDNA ORF Clone, Human
LILRA4 / CD85g Background Information
Full Name
leukocyte immunoglobulin like receptor A4

LILRA4 / CD85g cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LILRA4 / CD85g cDNA ORF Clone in Cloning Vector, Rhesus CG90204-G
LILRA4 / CD85g cDNA ORF Clone, Rhesus, untagged CG90204-UT
LILRA4 / CD85g Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90204-ACGLN
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90204-ACG
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90204-ACR
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90204-CF
LILRA4 / CD85g cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90204-NF
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-His tag CG90204-CH
LILRA4 / CD85g cDNA ORF Clone, Rhesus, N-His tag CG90204-NH
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-HA tag CG90204-CY
LILRA4 / CD85g cDNA ORF Clone, Rhesus, N-HA tag CG90204-NY
LILRA4 / CD85g cDNA ORF Clone, Rhesus, C-Myc tag CG90204-CM
LILRA4 / CD85g cDNA ORF Clone, Rhesus, N-Myc tag CG90204-NM

LILRA4 / CD85g cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LILRA4 / CD85g cDNA ORF Clone in Cloning Vector, Human HG16058-G
LILRA4 / CD85g cDNA ORF Clone, Human, untagged HG16058-UT
LILRA4 / CD85g Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16058-ACGLN
LILRA4 / CD85g cDNA ORF Clone, Human, C-GFPSpark® tag HG16058-ACG
LILRA4 / CD85g cDNA ORF Clone, Human, C-OFPSpark® tag HG16058-ACR
LILRA4 / CD85g cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16058-CF
LILRA4 / CD85g cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16058-NF
LILRA4 / CD85g cDNA ORF Clone, Human, C-His tag HG16058-CH
LILRA4 / CD85g cDNA ORF Clone, Human, C-HA tag HG16058-CY
LILRA4 / CD85g cDNA ORF Clone, Human, N-HA tag HG16058-NY
LILRA4 / CD85g cDNA ORF Clone, Human, C-Myc tag HG16058-CM
LILRA4 / CD85g cDNA ORF Clone, Human, N-Myc tag HG16058-NM
info info
添加购物车成功! 添加购物车失败!