LILRA3 cDNA ORF Clone, Human, C-His tag

Cat: HG13549-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LILRA3 Reagents
CRO Services
Product recommended

All LILRA3 Reagents
LILRA3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1320 bp
Description
Full length Clone DNA of Human leukocyte immunoglobulin-like receptor, subfamily with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LILRA3 cDNA ORF Clone, Human, C-His tag Alternative Names
CD85e cDNA ORF Clone, Human;HM31 cDNA ORF Clone, Human;HM43 cDNA ORF Clone, Human;ILT-6 cDNA ORF Clone, Human;ILT6 cDNA ORF Clone, Human;LIR-4 cDNA ORF Clone, Human;LIR4 cDNA ORF Clone, Human
LILRA3 Background Information

ILT6, also known as LILRA3, belongs to the ILT family. In human, the ILT gene family includes up to 11 members. The extracellular portion of all members includes at least two and usually four immuno-globulin domains. ILT-2 through 5 are all inhibitory members having variable numbers of cytoplasmic ITIM domains. ILT6 lacks a transmembrane domain. The function of ILT6 is currently unknown. however it is highly homologous to other LILR genes, and can bind human leukocyte antigen (HLA) class I. Therefore, if secreted, the ILT6 might impair interactions of membrane-bound LILRs (such as LILRB1, an inhibitory receptor expressed on effector and memory CD8 T cells) with their HLA ligands, thus modulating immune reactions and influencing susceptibility to disease.

Full Name
leukocyte immunoglobulin like receptor A3
References
  • Wi?niewski A, et al. (2004) Distribution of LILRA3 (ILT6 / LILRA3/LIR4) deletion in psoriatic patients and healthy controls. Hum Immunol. 64(4):458-61.
  • Norman PJ, et al. (2003) DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3. Immunogenetics. 55(3):165-71.
  • Cella M, et al. (1997) A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 185(10): 1743-51.
  • info info
    添加购物车成功! 添加购物车失败!