LIAS cDNA ORF Clone, Human, untagged

Cat: HG15314-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LIAS Reagents
CRO Services
Product recommended

All LIAS Reagents
LIAS cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Human lipoic acid synthetase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIAS cDNA ORF Clone, Human, untagged Alternative Names
HUSSY-01 cDNA ORF Clone, Human;LAS cDNA ORF Clone, Human;LIP1 cDNA ORF Clone, Human;LS cDNA ORF Clone, Human;PDHLD cDNA ORF Clone, Human
LIAS Background Information
Full Name
lipoic acid synthetase

LIAS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LIAS cDNA ORF Clone in Cloning Vector, Rat RG81668-G
LIAS cDNA ORF Clone, Rat, untagged RG81668-UT
LIAS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81668-ACGLN
LIAS cDNA ORF Clone, Rat, C-GFPSpark® tag RG81668-ACG
LIAS cDNA ORF Clone, Rat, N-GFPSpark® tag RG81668-ANG
LIAS cDNA ORF Clone, Rat, C-OFPSpark® tag RG81668-ACR
LIAS cDNA ORF Clone, Rat, N-OFPSpark® tag RG81668-ANR
LIAS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81668-CF
LIAS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81668-NF
LIAS cDNA ORF Clone, Rat, C-His tag RG81668-CH
LIAS cDNA ORF Clone, Rat, N-His tag RG81668-NH
LIAS cDNA ORF Clone, Rat, C-HA tag RG81668-CY
LIAS cDNA ORF Clone, Rat, N-HA tag RG81668-NY
LIAS cDNA ORF Clone, Rat, C-Myc tag RG81668-CM
LIAS cDNA ORF Clone, Rat, N-Myc tag RG81668-NM

LIAS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LIAS cDNA ORF Clone in Cloning Vector, Mouse MG51718-U
LIAS cDNA ORF Clone, Mouse, untagged MG51718-UT
LIAS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51718-ACG
LIAS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51718-ACGLN
LIAS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51718-ANG
LIAS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51718-ACR
LIAS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51718-ANR
LIAS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51718-CF
LIAS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51718-NF
LIAS cDNA ORF Clone, Mouse, C-His tag MG51718-CH
LIAS cDNA ORF Clone, Mouse, N-His tag MG51718-NH
LIAS cDNA ORF Clone, Mouse, C-HA tag MG51718-CY
LIAS cDNA ORF Clone, Mouse, N-HA tag MG51718-NY
LIAS cDNA ORF Clone, Mouse, C-Myc tag MG51718-CM
LIAS cDNA ORF Clone, Mouse, N-Myc tag MG51718-NM
LIAS qPCR Primer Pairs, Mouse MP201591

LIAS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LIAS cDNA ORF Clone in Cloning Vector, Human HG15314-G
LIAS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15314-ACGLN
LIAS cDNA ORF Clone, Human, C-GFPSpark® tag HG15314-ACG
LIAS cDNA ORF Clone, Human, N-GFPSpark® tag HG15314-ANG
LIAS cDNA ORF Clone, Human, C-OFPSpark® tag HG15314-ACR
LIAS cDNA ORF Clone, Human, N-OFPSpark® tag HG15314-ANR
LIAS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15314-CF
LIAS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15314-NF
LIAS cDNA ORF Clone, Human, C-His tag HG15314-CH
LIAS cDNA ORF Clone, Human, N-His tag HG15314-NH
LIAS cDNA ORF Clone, Human, C-HA tag HG15314-CY
LIAS cDNA ORF Clone, Human, N-HA tag HG15314-NY
LIAS cDNA ORF Clone, Human, C-Myc tag HG15314-CM
LIAS cDNA ORF Clone, Human, N-Myc tag HG15314-NM
LIAS qPCR Primer Pairs, Human HP103939
info info
添加购物车成功! 添加购物车失败!