Quick Order

Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human LGALS14 cDNA Clone Product Information
NCBI RefSeq:NM_020129.2
RefSeq ORF Size:420bp
cDNA Description:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
Gene Synonym:CLC2, PPL13, MGC22235, LGALS14
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11371-ACG$225
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11371-ACR$225
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11371-ANG$225
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11371-ANR$225
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-CF$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG11371-CH$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11371-CM$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG11371-CY$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11371-M$75
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-M-F$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11371-NF$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG11371-NH$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11371-NM$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG11371-NY$195
Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmidHG11371-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG11371-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"