Quick Order

Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human LGALS14 cDNA Clone Product Information
    NCBI RefSeq:NM_020129.2
    RefSeq ORF Size:420bp
    cDNA Description:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1 with N terminal His tag.
    Gene Synonym:CLC2, PPL13, MGC22235, LGALS14
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGALS14 qPCR primers for gene expression analysis, HP101253 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11371-ACG$225
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11371-ACR$225
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11371-ANG$225
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11371-ANR$225
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-CF$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG11371-CH$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11371-CM$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG11371-CY$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG11371-M$75
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11371-M-F$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11371-NF$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG11371-NH$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11371-NM$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG11371-NY$195
    Human Galectin-14/LGALS14 transcript variant 1 Gene ORF cDNA clone expression plasmidHG11371-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: HG11371-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"