Galectin-12/LGALS12 cDNA ORF Clone, Human, C-His tag

Cat: HG11135-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Galectin-12/LGALS12 Reagents
CRO Services
Product recommended

All Galectin-12/LGALS12 Reagents
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 12, transcript variant 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + NotI(6kb+1.06kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Galectin-12/LGALS12 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-12/LGALS12 cDNA ORF Clone, Human, C-His tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5643
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-His tag Alternative Names
GAL12 cDNA ORF Clone, Human;GRIP1 cDNA ORF Clone, Human
Galectin-12/LGALS12 Background Information
Full Name
lectin, galactoside-binding, soluble, 12

Galectin-12/LGALS12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Galectin-12/LGALS12 cDNA ORF Clone in Cloning Vector, Mouse MG52940-G
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, untagged MG52940-UT
Galectin-12/LGALS12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52940-ACGLN
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52940-ACG
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52940-ANG
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52940-ACR
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52940-ANR
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52940-CF
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52940-NF
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-His tag MG52940-CH
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-His tag MG52940-NH
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-HA tag MG52940-CY
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-HA tag MG52940-NY
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-Myc tag MG52940-CM
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-Myc tag MG52940-NM

Galectin-12/LGALS12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Galectin-12/LGALS12 cDNA ORF Clone in Cloning Vector, Human HG11135-M
Galectin-12/LGALS12 cDNA ORF Clone, Human, untagged HG11135-UT
Galectin-12/LGALS12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11135-ACGLN
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-GFPSpark® tag HG11135-ACG
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-GFPSpark® tag HG11135-ANG
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-OFPSpark® tag HG11135-ACR
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-OFPSpark® tag HG11135-ANR
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11135-CF
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11135-NF
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-His tag HG11135-NH
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-HA tag HG11135-CY
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-HA tag HG11135-NY
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-Myc tag HG11135-CM
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-Myc tag HG11135-NM
Galectin-12/LGALS12 qPCR Primer Pairs, Human HP101045
info info
添加购物车成功! 添加购物车失败!