Leptin Receptor cDNA ORF Clone, Human, N-Myc tag

Cat: HG10322-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Leptin Receptor Reagents
CRO Services
Product recommended

All Leptin Receptor Reagents
Leptin Receptor cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3498 bp
Description
Full length Clone DNA of Human leptin receptor, transcript variant 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Leptin Receptor cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD295 cDNA ORF Clone, Human;LEP-R cDNA ORF Clone, Human;LEPRD cDNA ORF Clone, Human;OB-R cDNA ORF Clone, Human;OBR cDNA ORF Clone, Human
Leptin Receptor Background Information

Leptin Receptor or CD295 belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Leptin Receptor/CD295 is a transmembrane catalytic receptors found on NPY/AgRP and alpha-MSH/CART neurons in hypothalamic nuclei. Leptin receptors (Ob-Rs) are coded for by one human gene that produces six different isoforms; Ob-Ra - Ob-Rf. Ob-Rs exist as constitutive dimers at physiological expression levels. Only the Ob-Rb isoform can transduce intracellular signals and does so through activation of the JAK2/STAT3, PI 3-K and MAPK signaling cascades. Activation of Ob-Rs mediates transcriptional regulation of the hypothalamic melanocortin pathway and downregulates endocannabinoid expression. Leptin acts via leptin receptors. Leptin resistance has been proposed as a pathophysiological mechanism of obesity. In obese individuals, Ob-Ra (which is involved in active transport of leptin across the blood-brain barrier) expression is downregulated and the individual may be unresponsive to leptin signals. Ob-R antagonists are of great interest in the development of pharmacological treatments for obesity. Mutations in Leptin Receptor/CD295 have been associated with obesity and pituitary dysfunction.

Full Name
leptin receptor
References
  • Heshka JT, et al. (2001) A role for dietary fat in leptin receptor, OB-Rb, function. Life Sci. 69 (9): 987-1003.
  • Chen H, et al (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell. 84 (3): 491-5.
  • Bjrbaek C, et al. (1998) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem. 272 (51): 32686-95.
  • info info
    添加购物车成功! 添加购物车失败!