LDB1 cDNA ORF Clone, Human, untagged

Cat: HG14413-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LDB1 Reagents
CRO Services
Product recommended

All LDB1 Reagents
LDB1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Human LIM domain binding 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LDB1 cDNA ORF Clone, Human, untagged Alternative Names
CLIM2 cDNA ORF Clone, Human;NLI cDNA ORF Clone, Human
LDB1 Background Information
Full Name
LIM domain binding 1

LDB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LDB1 cDNA ORF Clone in Cloning Vector, Mouse MG52729-G
LDB1 cDNA ORF Clone, Mouse, untagged MG52729-UT
LDB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52729-ACGLN
LDB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52729-ACG
LDB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52729-ANG
LDB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52729-ACR
LDB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52729-ANR
LDB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52729-CF
LDB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52729-NF
LDB1 cDNA ORF Clone, Mouse, C-His tag MG52729-CH
LDB1 cDNA ORF Clone, Mouse, N-His tag MG52729-NH
LDB1 cDNA ORF Clone, Mouse, C-HA tag MG52729-CY
LDB1 cDNA ORF Clone, Mouse, N-HA tag MG52729-NY
LDB1 cDNA ORF Clone, Mouse, C-Myc tag MG52729-CM
LDB1 cDNA ORF Clone, Mouse, N-Myc tag MG52729-NM
LDB1 qPCR Primer Pairs, Mouse MP202600

LDB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LDB1 cDNA ORF Clone in Cloning Vector, Human HG14413-G
LDB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14413-ACGLN
LDB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14413-ACG
LDB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14413-ANG
LDB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14413-ACR
LDB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14413-ANR
LDB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14413-CF
LDB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14413-NF
LDB1 cDNA ORF Clone, Human, C-His tag HG14413-CH
LDB1 cDNA ORF Clone, Human, N-His tag HG14413-NH
LDB1 cDNA ORF Clone, Human, C-HA tag HG14413-CY
LDB1 cDNA ORF Clone, Human, N-HA tag HG14413-NY
LDB1 cDNA ORF Clone, Human, C-Myc tag HG14413-CM
LDB1 cDNA ORF Clone, Human, N-Myc tag HG14413-NM
LDB1 qPCR Primer Pairs, Human HP103062
info info
添加购物车成功! 添加购物车失败!