LCAT cDNA ORF Clone, Human, N-Myc tag

Cat: HG13271-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LCAT Reagents
CRO Services
Product recommended

All LCAT Reagents
LCAT cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1323 bp
Description
Full length Clone DNA of Human lecithin-cholesterol acyltransferase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LCAT Background Information
Full Name
lecithin-cholesterol acyltransferase

LCAT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LCAT cDNA ORF Clone in Cloning Vector, Rat RG82831-U
LCAT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82831-ACGLN

LCAT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LCAT cDNA ORF Clone in Cloning Vector, Mouse MG58113-U
LCAT cDNA ORF Clone, Mouse, untagged MG58113-UT
LCAT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58113-ACG
LCAT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58113-ACGLN
LCAT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58113-ACR
LCAT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58113-CF
LCAT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58113-NF
LCAT cDNA ORF Clone, Mouse, C-His tag MG58113-CH
LCAT cDNA ORF Clone, Mouse, N-His tag MG58113-NH
LCAT cDNA ORF Clone, Mouse, C-HA tag MG58113-CY
LCAT cDNA ORF Clone, Mouse, N-HA tag MG58113-NY
LCAT cDNA ORF Clone, Mouse, C-Myc tag MG58113-CM
LCAT cDNA ORF Clone, Mouse, N-Myc tag MG58113-NM

LCAT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LCAT cDNA ORF Clone in Cloning Vector, Human HG13271-G
LCAT cDNA ORF Clone, Human, untagged HG13271-UT
LCAT cDNA ORF Clone, Human, C-GFPSpark® tag HG13271-ACG
LCAT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13271-ACGLN
LCAT cDNA ORF Clone, Human, C-OFPSpark® tag HG13271-ACR
LCAT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13271-CF
LCAT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13271-NF
LCAT cDNA ORF Clone, Human, C-His tag HG13271-CH
LCAT cDNA ORF Clone, Human, N-His tag HG13271-NH
LCAT cDNA ORF Clone, Human, C-HA tag HG13271-CY
LCAT cDNA ORF Clone, Human, N-HA tag HG13271-NY
LCAT cDNA ORF Clone, Human, C-Myc tag HG13271-CM
LCAT qPCR Primer Pairs, Human HP101980
info info
添加购物车成功! 添加购物车失败!