Quick Order

Human Lipopolysaccharide binding protein/LBP Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human LBP cDNA Clone Product Information
NCBI RefSeq:NM_004139.2
RefSeq ORF Size:1446bp
cDNA Description:Full length Clone DNA of Homo sapiens lipopolysaccharide binding protein with N terminal HA tag.
Gene Synonym:MGC22233
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Lipopolysaccharide binding protein/LBP Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Product nameProduct name
Background

Lipopolysaccharide binding protein ( LBP ) is a glycoprotein that is synthesized principally by hepatocytes. LBP is a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides ( LPSs ). LBP binds directly to the outer membrane of Gram-negative bacteria and to purified aggregates of extracted endotoxin, and catalyses the delivery of endotoxin to membrane ( mCD14,GPI-Linked ) and soluble ( sCD14 ) forms of CD14, thereby markedly increasing host cell sensitivity to endotoxin. LBP efficiently catalyses the transfer of individual molecules of endotoxin to (s)CD14 only when LBP–endotoxin aggregates are formed in the presence of albumin. In the presence of EDTA, LBP binding promotes further disaggregation of endotoxin. LBP binding does not have such drastic effects under more physiological conditions, but may still induce more subtle topological rearrangements of endotoxin.

References
  • J. Weiss, 2003, Biochemical Society Transactions: Volume 31, part 4: 785-790.
  • RR Schumann, et al., Science, 1990, Vol 249, Issue 4975: 1429-143.
  • Carsten J. Kirschning, et al., 1997, Genomics, Volume 46, Issue 3: 416-25.
  • Size / Price
    Catalog: HG10526-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"