LAT cDNA ORF Clone, Human, untagged

Cat: HG12094-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LAT Reagents
CRO Services
Product recommended

All LAT Reagents
LAT cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
789 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 447 G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human linker for activation of T cells.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.79kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LAT cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAT cDNA ORF Clone, Human, untagged Alternative Names
LAT1 cDNA ORF Clone, Human;pp36 cDNA ORF Clone, Human
LAT Background Information
Full Name
linker for activation of T cells

LAT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LAT cDNA ORF Clone in Cloning Vector, Mouse MG53813-U
LAT cDNA ORF Clone, Mouse, untagged MG53813-UT
LAT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53813-ACGLN
LAT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53813-ACG
LAT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53813-ACR
LAT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53813-CF
LAT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53813-NF
LAT cDNA ORF Clone, Mouse, C-His tag MG53813-CH
LAT cDNA ORF Clone, Mouse, N-His tag MG53813-NH
LAT cDNA ORF Clone, Mouse, C-HA tag MG53813-CY
LAT cDNA ORF Clone, Mouse, N-HA tag MG53813-NY
LAT cDNA ORF Clone, Mouse, C-Myc tag MG53813-CM
LAT cDNA ORF Clone, Mouse, N-Myc tag MG53813-NM

LAT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LAT cDNA ORF Clone in Cloning Vector, Human HG12094-G
LAT cDNA ORF Clone, Human, untagged HG12407-UT
LAT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12407-ACGLN
LAT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12094-ACGLN
LAT cDNA ORF Clone, Human, C-GFPSpark® tag HG12094-ACG
LAT cDNA ORF Clone, Human, C-OFPSpark® tag HG12094-ACR
LAT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12094-CF
LAT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12094-NF
LAT cDNA ORF Clone, Human, C-His tag HG12094-CH
LAT cDNA ORF Clone, Human, N-His tag HG12094-NH
LAT cDNA ORF Clone, Human, C-HA tag HG12094-CY
LAT cDNA ORF Clone, Human, N-HA tag HG12094-NY
LAT cDNA ORF Clone, Human, C-Myc tag HG12094-CM
LAT cDNA ORF Clone, Human, N-Myc tag HG12094-NM
LAT qPCR Primer Pairs, Human HP101622
info info
添加购物车成功! 添加购物车失败!