Quick Order

Human LAT Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LAT cDNA Clone Product Information
NCBI RefSeq:NM_014387.3
RefSeq ORF Size:789bp
cDNA Description:Full length Clone DNA of Homo sapiens linker for activation of T cells.
Gene Synonym:LAT1, pp36, LAT
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-LAT
Restriction Site:KpnI + XbaI (6.1kb + 0.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 447 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG12094-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"