Quick Order

Human LAMP2/CD107b Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human LAMP2 cDNA Clone Product Information
    NCBI RefSeq:BC002965
    RefSeq ORF Size:1233bp
    cDNA Description:Full length Clone DNA of Homo sapiens lysosomal-associated membrane protein 2 with N terminal HA tag.
    Gene Synonym:LAMPB, CD107b, LAMP-2, LGP110, LAMP2
    Species:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LAMP2 qPCR primers for gene expression analysis, HP102241 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    LAMP2 (Lysosomal-associated membrane protein 2), also known as CD107b (Cluster of Differentiation 107b), is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. In human, LAMP2, the causative gene of Danon disease, located on chromosome Xq24, encodes the lysosome-associated membrane protein-2 (LAMP-2). LAMP-2 deficiency, or Danon disease, is a rare X-linked lysosomal disease characterized by cardiomyopathy, vacuolar myopathy, and mental retardation. LAMP2 cardiomyopathy is an X-linked and highly progressive myocardial storage disorder associated with diminished survival, which clinically resembles sarcomeric hypertrophic cardiomyopathy.

    References
  • Maron BJ, et al. (2010) Profound left ventricular remodeling associated with LAMP2 cardiomyopathy. Am J Cardiol. 106(8): 1194-6.
  • Di Blasi C, et al. (2008) Danon disease: a novel LAMP2 mutation affecting the pre-mRNA splicing and causing aberrant transcripts and partial protein expression. Neuromuscul Disord. 18(12): 962-6.
  • Echaniz-Laguna A, et al. (2006) Novel Lamp-2 gene mutation and successful treatment with heart transplantation in a large family with Danon disease. Muscle Nerve. 33(3): 393-7.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"