After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LAIR2 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human LAIR2 cDNA Clone Product Information
NCBI RefSeq:NM_002288.3
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Homo sapiens leukocyte-associated immunoglobulin-like receptor 2 with N terminal His tag.
Gene Synonym:CD306, MGC71634
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Leukocyte-associated immunoglobulin-like receptor 2 ( LAIR2 ), also known as CD306, is a 131 amino acid protein containing one lg-like C2-type domain. It is expressed as a soluble receptor exhibiting high affinity for various collagen molecules to which it binds in a hydroxyproline-dependent manner. LAIR2 is a member of the immunoglobulin superfamily and was identified by its similarity to LAIR1, an inhibitory receptor present on mononuclear leukocytes. LAIR2 is thought to be secreted and may help modulate mucosal tolerance. As a natural competitor for LAIR1, soluble LAIR2 prevents binding of human LAIR1 to collagens and LAIR1 cross-linking, thereby regulating its inhibitory potential. Accordingly, LAIR2 is suggested to perform an immunoregulatory function.

References
  • Meyaard, L. et al.,1997, Immunity.7:283-290.
  • Meyaard, L. et al.,1999, J. Immunol. 162:5800-5804.
  • Meyaard, L. et al., 2001,  J. Exp. Med. 194 (1): 107-112.
  • Meyaard, L., 2003, J Biol Regul Homeost Agents.  17 (4): 330-333.
  • Lebbink, R. J. et al., 2008, J Immunol. 180 (3):1662-1669.
  • Lebbink,R.J. et al., 2009,  Matrix Biol.  28 (4):202-210.
  • Size / Price
    Catalog: HG10868-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeks
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"