Cytokeratin 8 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13153-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cytokeratin 8 Reagents
CRO Services
Product recommended

All Cytokeratin 8 Reagents
Cytokeratin 8 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1497 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human keratin 8 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Restriction Sites
KpnI + XbaI(6kb+1.5kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Cytokeratin 8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 8 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human bFGF/FGF2 Gene Plasmid Map 5639
Cytokeratin 8 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CARD2 cDNA ORF Clone, Human;CK-8 cDNA ORF Clone, Human;CK8 cDNA ORF Clone, Human;CYK8 cDNA ORF Clone, Human;K2C8 cDNA ORF Clone, Human;K8 cDNA ORF Clone, Human;KO cDNA ORF Clone, Human
Cytokeratin 8 Background Information
Full Name
keratin 8, type II

Cytokeratin 8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 8 cDNA ORF Clone in Cloning Vector, Rat RG81440-G

Cytokeratin 8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 8 cDNA ORF Clone in Cloning Vector, Mouse MG53192-G
Cytokeratin 8 cDNA ORF Clone, Mouse, untagged MG53192-UT
Cytokeratin 8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53192-ACG
Cytokeratin 8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53192-ACGLN
Cytokeratin 8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53192-ANG
Cytokeratin 8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53192-ACR
Cytokeratin 8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53192-ANR
Cytokeratin 8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53192-CF
Cytokeratin 8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53192-NF
Cytokeratin 8 cDNA ORF Clone, Mouse, C-His tag MG53192-CH
Cytokeratin 8 cDNA ORF Clone, Mouse, N-His tag MG53192-NH
Cytokeratin 8 cDNA ORF Clone, Mouse, C-HA tag MG53192-CY
Cytokeratin 8 cDNA ORF Clone, Mouse, N-HA tag MG53192-NY
Cytokeratin 8 cDNA ORF Clone, Mouse, C-Myc tag MG53192-CM
Cytokeratin 8 cDNA ORF Clone, Mouse, N-Myc tag MG53192-NM

Cytokeratin 8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 8 cDNA ORF Clone in Cloning Vector, Human HG13153-G
Cytokeratin 8 cDNA ORF Clone, Human, untagged HG13153-UT
Cytokeratin 8 cDNA ORF Clone, Human, C-GFPSpark® tag HG13153-ACG
Cytokeratin 8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13153-ACGLN
Cytokeratin 8 cDNA ORF Clone, Human, N-GFPSpark® tag HG13153-ANG
Cytokeratin 8 cDNA ORF Clone, Human, C-OFPSpark® tag HG13153-ACR
Cytokeratin 8 cDNA ORF Clone, Human, N-OFPSpark® tag HG13153-ANR
Cytokeratin 8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13153-CF
Cytokeratin 8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13153-NF
Cytokeratin 8 cDNA ORF Clone, Human, C-His tag HG13153-CH
Cytokeratin 8 cDNA ORF Clone, Human, N-His tag HG13153-NH
Cytokeratin 8 cDNA ORF Clone, Human, C-HA tag HG13153-CY
Cytokeratin 8 cDNA ORF Clone, Human, N-HA tag HG13153-NY
Cytokeratin 8 cDNA ORF Clone, Human, C-Myc tag HG13153-CM
Cytokeratin 8 qPCR Primer Pairs, Human HP101709
info info
添加购物车成功! 添加购物车失败!