Cytokeratin 5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13195-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytokeratin 5 Reagents
CRO Services
Product recommended

All Cytokeratin 5 Reagents
Cytokeratin 5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1773 bp
Description
Full length Clone DNA of Human keratin 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CK5 cDNA ORF Clone, Human;DDD cDNA ORF Clone, Human;DDD1 cDNA ORF Clone, Human;EBS2 cDNA ORF Clone, Human;K5 cDNA ORF Clone, Human;KRT5A cDNA ORF Clone, Human
Cytokeratin 5 Background Information
Full Name
keratin 5, type II

Cytokeratin 5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Rat RG80942-U
Cytokeratin 5 cDNA ORF Clone, Rat, untagged RG80942-UT
Cytokeratin 5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80942-ACGLN
Cytokeratin 5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80942-ACG
Cytokeratin 5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80942-ANG
Cytokeratin 5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80942-ACR
Cytokeratin 5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80942-ANR
Cytokeratin 5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80942-CF
Cytokeratin 5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80942-NF
Cytokeratin 5 cDNA ORF Clone, Rat, C-His tag RG80942-CH
Cytokeratin 5 cDNA ORF Clone, Rat, N-His tag RG80942-NH
Cytokeratin 5 cDNA ORF Clone, Rat, C-HA tag RG80942-CY
Cytokeratin 5 cDNA ORF Clone, Rat, N-HA tag RG80942-NY
Cytokeratin 5 cDNA ORF Clone, Rat, C-Myc tag RG80942-CM
Cytokeratin 5 cDNA ORF Clone, Rat, N-Myc tag RG80942-NM
Cytokeratin 5 qPCR Primer Pairs, Rat RP300906

Cytokeratin 5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Mouse MG52985-G
Cytokeratin 5 cDNA ORF Clone, Mouse, untagged MG52985-UT
Cytokeratin 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52985-ACGLN
Cytokeratin 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52985-ACG
Cytokeratin 5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52985-ANG
Cytokeratin 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52985-ACR
Cytokeratin 5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52985-ANR
Cytokeratin 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52985-CF
Cytokeratin 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52985-NF
Cytokeratin 5 cDNA ORF Clone, Mouse, C-His tag MG52985-CH
Cytokeratin 5 cDNA ORF Clone, Mouse, N-His tag MG52985-NH
Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag MG52985-CY
Cytokeratin 5 cDNA ORF Clone, Mouse, N-HA tag MG52985-NY
Cytokeratin 5 cDNA ORF Clone, Mouse, C-Myc tag MG52985-CM
Cytokeratin 5 cDNA ORF Clone, Mouse, N-Myc tag MG52985-NM

Cytokeratin 5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Human HG13195-G
Cytokeratin 5 cDNA ORF Clone, Human, untagged HG13195-UT
Cytokeratin 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13195-ACG
Cytokeratin 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13195-ACGLN
Cytokeratin 5 cDNA ORF Clone, Human, N-GFPSpark® tag HG13195-ANG
Cytokeratin 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13195-ACR
Cytokeratin 5 cDNA ORF Clone, Human, N-OFPSpark® tag HG13195-ANR
Cytokeratin 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13195-CF
Cytokeratin 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13195-NF
Cytokeratin 5 cDNA ORF Clone, Human, C-His tag HG13195-CH
Cytokeratin 5 cDNA ORF Clone, Human, N-His tag HG13195-NH
Cytokeratin 5 cDNA ORF Clone, Human, C-HA tag HG13195-CY
Cytokeratin 5 cDNA ORF Clone, Human, N-HA tag HG13195-NY
Cytokeratin 5 cDNA ORF Clone, Human, C-Myc tag HG13195-CM
Cytokeratin 5 qPCR Primer Pairs, Human HP101774
info info
添加购物车成功! 添加购物车失败!