Cytokeratin 20 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13198-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytokeratin 20 Reagents
CRO Services
Product recommended

All Cytokeratin 20 Reagents
Cytokeratin 20 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Human keratin 20 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 20 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD20 cDNA ORF Clone, Human;CK-20 cDNA ORF Clone, Human;CK20 cDNA ORF Clone, Human;K20 cDNA ORF Clone, Human;KRT21 cDNA ORF Clone, Human
Cytokeratin 20 Background Information
Full Name
keratin 20, type I

Cytokeratin 20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 20 cDNA ORF Clone in Cloning Vector, Mouse MG5A1216-U
Cytokeratin 20 cDNA ORF Clone, Mouse, untagged MG5A1216-UT
Cytokeratin 20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1216-ACG
Cytokeratin 20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1216-ACGLN
Cytokeratin 20 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1216-ANG
Cytokeratin 20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1216-ACR
Cytokeratin 20 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1216-ANR
Cytokeratin 20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1216-CF
Cytokeratin 20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1216-NF
Cytokeratin 20 cDNA ORF Clone, Mouse, C-His tag MG5A1216-CH
Cytokeratin 20 cDNA ORF Clone, Mouse, N-His tag MG5A1216-NH
Cytokeratin 20 cDNA ORF Clone, Mouse, C-HA tag MG5A1216-CY
Cytokeratin 20 cDNA ORF Clone, Mouse, N-HA tag MG5A1216-NY
Cytokeratin 20 cDNA ORF Clone, Mouse, C-Myc tag MG5A1216-CM
Cytokeratin 20 cDNA ORF Clone, Mouse, N-Myc tag MG5A1216-NM

Cytokeratin 20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 20 cDNA ORF Clone in Cloning Vector, Human HG13198-G
Cytokeratin 20 cDNA ORF Clone, Human, untagged HG13198-UT
Cytokeratin 20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13198-ACGLN
Cytokeratin 20 cDNA ORF Clone, Human, C-GFPSpark® tag HG13198-ACG
Cytokeratin 20 cDNA ORF Clone, Human, N-GFPSpark® tag HG13198-ANG
Cytokeratin 20 cDNA ORF Clone, Human, C-OFPSpark® tag HG13198-ACR
Cytokeratin 20 cDNA ORF Clone, Human, N-OFPSpark® tag HG13198-ANR
Cytokeratin 20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13198-CF
Cytokeratin 20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13198-NF
Cytokeratin 20 cDNA ORF Clone, Human, C-His tag HG13198-CH
Cytokeratin 20 cDNA ORF Clone, Human, N-His tag HG13198-NH
Cytokeratin 20 cDNA ORF Clone, Human, C-HA tag HG13198-CY
Cytokeratin 20 cDNA ORF Clone, Human, N-HA tag HG13198-NY
Cytokeratin 20 cDNA ORF Clone, Human, C-Myc tag HG13198-CM
Cytokeratin 20 qPCR Primer Pairs, Human HP101777
info info
添加购物车成功! 添加购物车失败!