Cytokeratin 19 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13154-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytokeratin 19 Reagents
CRO Services
Product recommended

All Cytokeratin 19 Reagents
Cytokeratin 19 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1203 bp
Description
Full length Clone DNA of Human keratin 19 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 19 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CK19 cDNA ORF Clone, Human;K19 cDNA ORF Clone, Human;K1CS cDNA ORF Clone, Human
Cytokeratin 19 Background Information
Full Name
keratin 19, type I

Cytokeratin 19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Rat RG80785-U
Cytokeratin 19 cDNA ORF Clone, Rat, untagged RG80785-UT
Cytokeratin 19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80785-ACG
Cytokeratin 19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80785-ACGLN
Cytokeratin 19 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80785-ANG
Cytokeratin 19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80785-ACR
Cytokeratin 19 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80785-ANR
Cytokeratin 19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80785-CF
Cytokeratin 19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80785-NF
Cytokeratin 19 cDNA ORF Clone, Rat, C-His tag RG80785-CH
Cytokeratin 19 cDNA ORF Clone, Rat, N-His tag RG80785-NH
Cytokeratin 19 cDNA ORF Clone, Rat, C-HA tag RG80785-CY
Cytokeratin 19 cDNA ORF Clone, Rat, N-HA tag RG80785-NY
Cytokeratin 19 cDNA ORF Clone, Rat, C-Myc tag RG80785-CM
Cytokeratin 19 cDNA ORF Clone, Rat, N-Myc tag RG80785-NM
Cytokeratin 19 qPCR Primer Pairs, Rat RP300749

Cytokeratin 19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Mouse MG53230-G
Cytokeratin 19 cDNA ORF Clone, Mouse, untagged MG53230-UT
Cytokeratin 19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53230-ACG
Cytokeratin 19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53230-ACGLN
Cytokeratin 19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53230-ANG
Cytokeratin 19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53230-ACR
Cytokeratin 19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53230-ANR
Cytokeratin 19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53230-CF
Cytokeratin 19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53230-NF
Cytokeratin 19 cDNA ORF Clone, Mouse, C-His tag MG53230-CH
Cytokeratin 19 cDNA ORF Clone, Mouse, N-His tag MG53230-NH
Cytokeratin 19 cDNA ORF Clone, Mouse, C-HA tag MG53230-CY
Cytokeratin 19 cDNA ORF Clone, Mouse, N-HA tag MG53230-NY
Cytokeratin 19 cDNA ORF Clone, Mouse, C-Myc tag MG53230-CM
Cytokeratin 19 cDNA ORF Clone, Mouse, N-Myc tag MG53230-NM

Cytokeratin 19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 19 cDNA ORF Clone in Cloning Vector, Human HG13154-G
Cytokeratin 19 cDNA ORF Clone, Human, untagged HG13154-UT
Cytokeratin 19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13154-ACGLN
Cytokeratin 19 cDNA ORF Clone, Human, C-GFPSpark® tag HG13154-ACG
Cytokeratin 19 cDNA ORF Clone, Human, N-GFPSpark® tag HG13154-ANG
Cytokeratin 19 cDNA ORF Clone, Human, C-OFPSpark® tag HG13154-ACR
Cytokeratin 19 cDNA ORF Clone, Human, N-OFPSpark® tag HG13154-ANR
Cytokeratin 19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13154-CF
Cytokeratin 19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13154-NF
Cytokeratin 19 cDNA ORF Clone, Human, C-His tag HG13154-CH
Cytokeratin 19 cDNA ORF Clone, Human, N-His tag HG13154-NH
Cytokeratin 19 cDNA ORF Clone, Human, C-HA tag HG13154-CY
Cytokeratin 19 cDNA ORF Clone, Human, N-HA tag HG13154-NY
Cytokeratin 19 cDNA ORF Clone, Human, C-Myc tag HG13154-CM
Cytokeratin 19 qPCR Primer Pairs, Human HP101710
info info
添加购物车成功! 添加购物车失败!