Cytokeratin 15 cDNA ORF Clone, Human, N-His tag

Cat: HG13210-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytokeratin 15 Reagents
CRO Services
Product recommended

All Cytokeratin 15 Reagents
Cytokeratin 15 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1371 bp
Description
Full length Clone DNA of Human keratin 15 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 15 cDNA ORF Clone, Human, N-His tag Alternative Names
CK15 cDNA ORF Clone, Human;K15 cDNA ORF Clone, Human;K1CO cDNA ORF Clone, Human
Cytokeratin 15 Background Information
Full Name
keratin 15, type I

Cytokeratin 15 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 15 cDNA ORF Clone in Cloning Vector, Rat RG80986-U
Cytokeratin 15 cDNA ORF Clone, Rat, untagged RG80986-UT
Cytokeratin 15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80986-ACGLN
Cytokeratin 15 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80986-ACG
Cytokeratin 15 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80986-ANG
Cytokeratin 15 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80986-ACR
Cytokeratin 15 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80986-ANR
Cytokeratin 15 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80986-CF
Cytokeratin 15 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80986-NF
Cytokeratin 15 cDNA ORF Clone, Rat, C-His tag RG80986-CH
Cytokeratin 15 cDNA ORF Clone, Rat, N-His tag RG80986-NH
Cytokeratin 15 cDNA ORF Clone, Rat, C-HA tag RG80986-CY
Cytokeratin 15 cDNA ORF Clone, Rat, N-HA tag RG80986-NY
Cytokeratin 15 cDNA ORF Clone, Rat, C-Myc tag RG80986-CM
Cytokeratin 15 cDNA ORF Clone, Rat, N-Myc tag RG80986-NM
Cytokeratin 15 qPCR Primer Pairs, Rat RP300950

Cytokeratin 15 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 15 cDNA ORF Clone in Cloning Vector, Human HG13210-G
Cytokeratin 15 cDNA ORF Clone, Human, untagged HG13210-UT
Cytokeratin 15 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13210-ACGLN
Cytokeratin 15 cDNA ORF Clone, Human, C-GFPSpark® tag HG13210-ACG
Cytokeratin 15 cDNA ORF Clone, Human, N-GFPSpark® tag HG13210-ANG
Cytokeratin 15 cDNA ORF Clone, Human, C-OFPSpark® tag HG13210-ACR
Cytokeratin 15 cDNA ORF Clone, Human, N-OFPSpark® tag HG13210-ANR
Cytokeratin 15 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13210-CF
Cytokeratin 15 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13210-NF
Cytokeratin 15 cDNA ORF Clone, Human, C-His tag HG13210-CH
Cytokeratin 15 cDNA ORF Clone, Human, C-HA tag HG13210-CY
Cytokeratin 15 cDNA ORF Clone, Human, N-HA tag HG13210-NY
Cytokeratin 15 cDNA ORF Clone, Human, C-Myc tag HG13210-CM
Cytokeratin 15 cDNA ORF Clone, Human, N-Myc tag HG13210-NM
Cytokeratin 15 qPCR Primer Pairs, Human HP101781
info info
添加购物车成功! 添加购物车失败!