KRAS cDNA ORF Clone, Human, N-HA tag

Cat: HG12259-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All KRAS Reagents
CRO Services
Product recommended

All KRAS Reagents
KRAS cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
609 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-Ki-ras2 Kirsten rat sarcoma viral oncogene homol with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
HindIII + NotI(6kb+0.61kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
KRAS cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KRAS cDNA ORF Clone, Human, N-HA tag Validated Images
Human alcohol dehydrogenase 1A/ADH1A Gene Plasmid Map 15466
KRAS cDNA ORF Clone, Human, N-HA tag Alternative Names
C-K-RAS cDNA ORF Clone, Human;CFC2 cDNA ORF Clone, Human;K-RAS cDNA ORF Clone, Human;K-RAS2A cDNA ORF Clone, Human;K-RAS2B cDNA ORF Clone, Human;K-RAS4A cDNA ORF Clone, Human;K-RAS4B cDNA ORF Clone, Human;KI-RAS cDNA ORF Clone, Human;KRAS1 cDNA ORF Clone, Human;KRAS2 cDNA ORF Clone, Human;NS cDNA ORF Clone, Human;NS3 cDNA ORF Clone, Human;RALD cDNA ORF Clone, Human;RASK2 cDNA ORF Clone, Human
KRAS Background Information

K-Ras belongs to the small GTPase superfamily, Ras family. As other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example RasGAP. In turn K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations have been found to be associated with Noonan syndrome[4] and cardio-facio-cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer and lung cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
Kirsten rat sarcoma viral oncogene homolog
References
  • Ling J, et al. (2012) KrasG12D-induced IKK2//NF-B activation by IL-1 alpha and p62 feedforward loops is required for development of pancreatic ductal adenocarcinoma. Cancer Cell. 21(1):105-20.
  • Matallanas D, et al. (2011) Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44(6):893-906.
  • Regala RP, et al. (2011) Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS One. 6(10):e26439.
  • KRAS cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    KRAS cDNA ORF Clone, Mouse, untagged MG56972-UT
    KRAS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56972-ACG
    KRAS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG56972-ACGLN
    KRAS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG56972-ACR
    KRAS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG56972-CF
    KRAS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG56972-NF
    KRAS cDNA ORF Clone, Mouse, C-His tag MG56972-CH
    KRAS cDNA ORF Clone, Mouse, N-His tag MG56972-NH
    KRAS cDNA ORF Clone, Mouse, C-HA tag MG56972-CY
    KRAS cDNA ORF Clone, Mouse, N-HA tag MG56972-NY
    KRAS cDNA ORF Clone, Mouse, C-Myc tag MG56972-CM
    KRAS cDNA ORF Clone, Mouse, N-Myc tag MG56972-NM

    KRAS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    KRAS cDNA ORF Clone in Cloning Vector, Human HG12259-G
    KRAS cDNA ORF Clone, Human, untagged HG12259-UT
    KRAS cDNA ORF Clone, Human, C-GFPSpark® tag HG12259-ACG
    KRAS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12259-ACGLN
    KRAS cDNA ORF Clone, Human, N-GFPSpark® tag HG12259-ANG
    KRAS cDNA ORF Clone, Human, C-OFPSpark® tag HG12259-ACR
    KRAS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12259-CF
    KRAS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12259-NF
    KRAS cDNA ORF Clone, Human, C-His tag HG12259-CH
    KRAS cDNA ORF Clone, Human, N-His tag HG12259-NH
    KRAS cDNA ORF Clone, Human, C-HA tag HG12259-CY
    KRAS cDNA ORF Clone, Human, C-Myc tag HG12259-CM
    KRAS cDNA ORF Clone, Human, N-Myc tag HG12259-NM
    KRAS qPCR Primer Pairs, Human HP101925
    info info
    添加购物车成功! 添加购物车失败!