Quick Order

Human KPNA2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KPNA2 cDNA Clone Product Information
NCBI RefSeq:BC005978
RefSeq ORF Size:1590bp
cDNA Description:Full length Clone DNA of Homo sapiens karyopherin alpha 2 (RAG cohort 1, importin alpha 1).
Gene Synonym:QIP2, RCH1, IPOA1, SRP1alpha
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG14475-UT
List Price:   (Save )
Price:      [How to order]
Availability
 Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"