KPNA1/SRP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14999-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KPNA1/SRP1 Reagents
CRO Services
Product recommended

All KPNA1/SRP1 Reagents
KPNA1/SRP1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1617 bp
Description
Full length Clone DNA of Human karyopherin alpha 1 (importin alpha 5) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KPNA1/SRP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
IPOA5 cDNA ORF Clone, Human;NPI-1 cDNA ORF Clone, Human;RCH2 cDNA ORF Clone, Human;SRP1 cDNA ORF Clone, Human
KPNA1/SRP1 Background Information
Full Name
karyopherin alpha 1 (importin alpha 5)

KPNA1/SRP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KPNA1/SRP1 cDNA ORF Clone in Cloning Vector, Mouse MG58731-U
KPNA1/SRP1 cDNA ORF Clone, Mouse, untagged MG58731-UT
KPNA1/SRP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58731-ACGLN
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58731-ACG
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58731-ANG
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58731-ACR
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58731-ANR
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58731-CF
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58731-NF
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-His tag MG58731-CH
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-His tag MG58731-NH
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-HA tag MG58731-CY
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-HA tag MG58731-NY
KPNA1/SRP1 cDNA ORF Clone, Mouse, C-Myc tag MG58731-CM
KPNA1/SRP1 cDNA ORF Clone, Mouse, N-Myc tag MG58731-NM

KPNA1/SRP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KPNA1/SRP1 cDNA ORF Clone in Cloning Vector, Human HG14999-G
KPNA1/SRP1 cDNA ORF Clone, Human, untagged HG14999-UT
KPNA1/SRP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14999-ACG
KPNA1/SRP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14999-ACGLN
KPNA1/SRP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14999-ANG
KPNA1/SRP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14999-ACR
KPNA1/SRP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14999-ANR
KPNA1/SRP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14999-CF
KPNA1/SRP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14999-NF
KPNA1/SRP1 cDNA ORF Clone, Human, C-His tag HG14999-CH
KPNA1/SRP1 cDNA ORF Clone, Human, N-His tag HG14999-NH
KPNA1/SRP1 cDNA ORF Clone, Human, C-HA tag HG14999-CY
KPNA1/SRP1 cDNA ORF Clone, Human, N-HA tag HG14999-NY
KPNA1/SRP1 cDNA ORF Clone, Human, C-Myc tag HG14999-CM
KPNA1/SRP1 qPCR Primer Pairs, Human HP103627
info info
添加购物车成功! 添加购物车失败!