Quick Order

Text Size:AAA

Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human KNG1 cDNA Clone Product Information
NCBI RefSeq:NM_001102416.2
RefSeq ORF Size:1935bp
cDNA Description:Full length Clone DNA of Homo sapiens kininogen 1, transcript variant 1 with C terminal His tag.
Gene Synonym:BDK, KNG
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10529-ACG$245
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10529-ACR$245
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10529-CF$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10529-CH$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10529-CM$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10529-CY$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10529-M$75
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10529-M-F$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10529-M-N$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10529-NF$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10529-NH$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10529-NM$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10529-NY$215
Human KNG1/Kininogen 1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10529-UT$215
 Learn more about expression Vectors
Product nameProduct name
Background

Mouse kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains three cystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of the kininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.

Size / Price
Catalog: HG10529-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"