Quick Order

Human KLK6/Kallikrein 6/Neurosin Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KLK6 cDNA Clone Product Information
NCBI RefSeq:BC015525
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 6.
Gene Synonym:hK6, Bssp, Klk7, SP59, PRSS9, PRSS18, MGC9355, KLK6
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-KLK6
Restriction Site:KpnI + XbaI (6.1kb + 0.74kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human KLK6 Gene Plasmid Map
Human KLK6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

KLK6 (kallikrein-related peptidase 6), also known as Klk7, belongs to the peptidase S1 family, Kallikrein subfamily. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. KLK6 is a serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Klk7 shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. KLK6 degrades alpha-synuclein and prevents its polymerization, indicating that KLK6 may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. Klk7 may be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis.

References
  • Krenzer S, et al. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol. 131(11):2281-8.
  • Nathalie HV, et al. (2009) High kallikrein-related peptidase 6 in non-small cell lung cancer cells: an indicator of tumour proliferation and poor prognosis. J Cell Mol Med. 13(9B):4014-22.
  • Kim JT, et al. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer. 117(12):2608-19.
  • Scarisbrick IA, et al. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One. 6(3):e18376.
  • Size / Price
    Catalog: HG12142-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human KLK6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"