Quick Order

Text Size:AAA

Human KLK-3 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KLK3 cDNA Clone Product Information
NCBI RefSeq:NM_001648.2
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1.
Gene Synonym:APS, PSA, hK3, KLK2A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-KLK3
Restriction Site:HindIII + XbaI (6.1kb + 0.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human KLK3 Gene Plasmid Map
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.
  • Size / Price
    Catalog: HG10771-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"