Quick Order

Human KLK3 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human KLK3 cDNA Clone Product Information
NCBI RefSeq:NM_001648.2
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1.
Gene Synonym:APS, PSA, hK3, KLK2A1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-KLK3
Restriction Site:HindIII + XbaI (6.1kb + 0.79kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with KLK3 qPCR primers for gene expression analysis, HP100692 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human KLK3 Gene Plasmid Map
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

KLK3(Kallikrein 3), also known as Prostate Specific Antigen (PSA), kallikrein-related peptidase 3, Gamma-seminoprotein, is a secreted protein of the glandular kallikrein subfamily of serine proteases.KLK3 contains one peptidase S1 domain.KLK3 is a glycoprotein produced almost exclusively by the prostate gland. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.
  • Size / Price
    Catalog: HG10771-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"