Quick Order

Text Size:AAA

Human KLK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human KLK3 cDNA Clone Product Information
NCBI RefSeq:NM_001648.2
RefSeq ORF Size:786bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1 with N terminal His tag.
Gene Synonym:APS, PSA, hK3, KLK2A1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

KLK3(Kallikrein 3), also known as Prostate Specific Antigen (PSA), kallikrein-related peptidase 3, Gamma-seminoprotein, is a secreted protein of the glandular kallikrein subfamily of serine proteases.KLK3 contains one peptidase S1 domain.KLK3 is a glycoprotein produced almost exclusively by the prostate gland. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers.

References
  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.
  • Size / Price
    Catalog: HG10771-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"