Kallikrein 11 cDNA ORF Clone, Human, N-His tag

Cat: HG10767-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kallikrein 11 Reagents
CRO Services
Product recommended

All Kallikrein 11 Reagents
Kallikrein 11 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Human kallikrein-related peptidase 11 , transcript variant 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kallikrein 11 cDNA ORF Clone, Human, N-His tag Alternative Names
KLK11 cDNA ORF Clone, Human;PRSS20 cDNA ORF Clone, Human;TLSP cDNA ORF Clone, Human
Kallikrein 11 Background Information

kallikrein-related peptidase 11 (KLK11), also known as hippostasin, trypsin-like serine protease and PRSS20, is a member of human tissue kallikrein family. It is a subgroup of serine proteases with diverse physiological functions, which is implicated in carcinogenesis and some with potential that serving as novel biomarkers for ovarian and prostate cancer and other diseases. The KLK11 gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Two alternatively spliced forms exist, resulting in 250 (isoform 1) and 282 (isoform 2) amino acid sequences. Isoform 2 is identical to isoform 1, except for an inserted 32 amino acid segment. Isoform 1 is predominantly expressed in brain whereas isoform 2 is preferentially expressed in prostate.

Full Name
kallikrein-related peptidase 11
References
  • Yoshida S., et al.,(1998), cDNA cloning and expression of a novel serine protease, TLSP. Biochim. Biophys. Acta 1399:225-228.
  • Mitsui S., et al., (2000), A novel isoform of a kallikrein-like protease, TLSP/hippostasin, (PRSS20), is expressed in the human brain and prostate.Biochem. Biophys. Res. Commun. 272:205-211.
  • Yousef G.M., et al.,(2000), Genomic organization, mapping, tissue expression, and hormonal regulation of trypsin-like serine protease (TLSP PRSS20), a new member of the human kallikrein gene family.Genomics 63:88-96.
  • Kallikrein 11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 11 cDNA ORF Clone in Cloning Vector, Mouse MG50919-G
    Kallikrein 11 cDNA ORF Clone, Mouse, untagged MG50919-UT
    Kallikrein 11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50919-ACG
    Kallikrein 11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50919-ACGLN
    Kallikrein 11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50919-ACR
    Kallikrein 11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50919-CF
    Kallikrein 11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50919-NF
    Kallikrein 11 cDNA ORF Clone, Mouse, C-His tag MG50919-CH
    Kallikrein 11 cDNA ORF Clone, Mouse, N-His tag MG50919-NH
    Kallikrein 11 cDNA ORF Clone, Mouse, C-HA tag MG50919-CY
    Kallikrein 11 cDNA ORF Clone, Mouse, N-HA tag MG50919-NY
    Kallikrein 11 cDNA ORF Clone, Mouse, C-Myc tag MG50919-CM
    Kallikrein 11 cDNA ORF Clone, Mouse, N-Myc tag MG50919-NM
    Kallikrein 11 qPCR Primer Pairs, Mouse MP200888

    Kallikrein 11 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 11 cDNA ORF Clone in Cloning Vector, Human HG10767-M
    Kallikrein 11 cDNA ORF Clone, Human, untagged HG10767-UT
    Kallikrein 11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10767-ACGLN
    Kallikrein 11 cDNA ORF Clone, Human, C-GFPSpark® tag HG10767-ACG
    Kallikrein 11 cDNA ORF Clone, Human, C-OFPSpark® tag HG10767-ACR
    Kallikrein 11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10767-CF
    Kallikrein 11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10767-NF
    Kallikrein 11 cDNA ORF Clone, Human, C-His tag HG10767-CH
    Kallikrein 11 cDNA ORF Clone, Human, C-HA tag HG10767-CY
    Kallikrein 11 cDNA ORF Clone, Human, N-HA tag HG10767-NY
    Kallikrein 11 cDNA ORF Clone, Human, C-Myc tag HG10767-CM
    Kallikrein 11 cDNA ORF Clone, Human, N-Myc tag HG10767-NM
    Kallikrein 11 qPCR Primer Pairs, Human HP100689
    info info
    添加购物车成功! 添加购物车失败!