After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK11/Kallikrein 11 transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human KLK11 cDNA Clone Product Information
NCBI RefSeq:NM_006853.2
RefSeq ORF Size:753bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 11 , transcript variant 1.
Gene Synonym:TLSP, PRSS20, MGC33060
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

kallikrein-related peptidase 11 (KLK11), also known as hippostasin, trypsin-like serine protease and PRSS20, is a member of human tissue kallikrein family. It is a subgroup of serine proteases with diverse physiological functions, which is implicated in carcinogenesis and some with potential that serving as novel biomarkers for ovarian and prostate cancer and other diseases. The KLK11 gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Two alternatively spliced forms exist, resulting in 250 (isoform 1) and 282 (isoform 2) amino acid sequences. Isoform 2 is identical to isoform 1, except for an inserted 32 amino acid segment. Isoform 1 is predominantly expressed in brain whereas isoform 2 is preferentially expressed in prostate.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"