KLHDC3 cDNA ORF Clone, Human, untagged

Cat: HG14417-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KLHDC3 Reagents
CRO Services
Product recommended

All KLHDC3 Reagents
KLHDC3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Human kelch domain containing 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLHDC3 cDNA ORF Clone, Human, untagged Alternative Names
dJ20C7.3 cDNA ORF Clone, Human;PEAS cDNA ORF Clone, Human
KLHDC3 Background Information
Full Name
kelch domain containing 3

KLHDC3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
KLHDC3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90652-G
KLHDC3 cDNA ORF Clone, Cynomolgus, untagged CG90652-UT
KLHDC3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90652-ACGLN
KLHDC3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90652-ACG
KLHDC3 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90652-ANG
KLHDC3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90652-ACR
KLHDC3 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90652-ANR
KLHDC3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90652-CF
KLHDC3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90652-NF
KLHDC3 cDNA ORF Clone, Cynomolgus, C-His tag CG90652-CH
KLHDC3 cDNA ORF Clone, Cynomolgus, N-His tag CG90652-NH
KLHDC3 cDNA ORF Clone, Cynomolgus, C-HA tag CG90652-CY
KLHDC3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90652-NY
KLHDC3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90652-CM
KLHDC3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90652-NM

KLHDC3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
KLHDC3 cDNA ORF Clone in Cloning Vector, Rat RG81471-G

KLHDC3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KLHDC3 cDNA ORF Clone in Cloning Vector, Mouse MG52081-U
KLHDC3 cDNA ORF Clone, Mouse, untagged MG52081-UT
KLHDC3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52081-ACG
KLHDC3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52081-ACGLN
KLHDC3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52081-ANG
KLHDC3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52081-ACR
KLHDC3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52081-ANR
KLHDC3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52081-CF
KLHDC3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52081-NF
KLHDC3 cDNA ORF Clone, Mouse, C-His tag MG52081-CH
KLHDC3 cDNA ORF Clone, Mouse, N-His tag MG52081-NH
KLHDC3 cDNA ORF Clone, Mouse, C-HA tag MG52081-CY
KLHDC3 cDNA ORF Clone, Mouse, N-HA tag MG52081-NY
KLHDC3 cDNA ORF Clone, Mouse, C-Myc tag MG52081-CM
KLHDC3 cDNA ORF Clone, Mouse, N-Myc tag MG52081-NM
KLHDC3 qPCR Primer Pairs, Mouse MP201954

KLHDC3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KLHDC3 cDNA ORF Clone in Cloning Vector, Human HG14417-G
KLHDC3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14417-ACG
KLHDC3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14417-ACGLN
KLHDC3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14417-ANG
KLHDC3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14417-ACR
KLHDC3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14417-ANR
KLHDC3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14417-CF
KLHDC3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14417-NF
KLHDC3 cDNA ORF Clone, Human, C-His tag HG14417-CH
KLHDC3 cDNA ORF Clone, Human, N-His tag HG14417-NH
KLHDC3 cDNA ORF Clone, Human, C-HA tag HG14417-CY
KLHDC3 cDNA ORF Clone, Human, N-HA tag HG14417-NY
KLHDC3 cDNA ORF Clone, Human, C-Myc tag HG14417-CM
KLHDC3 cDNA ORF Clone, Human, N-Myc tag HG14417-NM
KLHDC3 qPCR Primer Pairs, Human HP103066
info info
添加购物车成功! 添加购物车失败!