KLHDC2 cDNA ORF Clone, Human, C-HA tag

Cat: HG14191-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KLHDC2 Reagents
CRO Services
Product recommended

All KLHDC2 Reagents
KLHDC2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1221 bp
Description
Full length Clone DNA of Human kelch domain containing 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLHDC2 cDNA ORF Clone, Human, C-HA tag Alternative Names
HCLP-1 cDNA ORF Clone, Human;HCLP1 cDNA ORF Clone, Human;LCP cDNA ORF Clone, Human
KLHDC2 Background Information
Full Name
kelch domain containing 2

KLHDC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KLHDC2 cDNA ORF Clone in Cloning Vector, Mouse MG51979-G
KLHDC2 cDNA ORF Clone, Mouse, untagged MG51979-UT
KLHDC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51979-ACG
KLHDC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51979-ACGLN
KLHDC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51979-ANG
KLHDC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51979-ACR
KLHDC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51979-ANR
KLHDC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51979-CF
KLHDC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51979-NF
KLHDC2 cDNA ORF Clone, Mouse, C-His tag MG51979-CH
KLHDC2 cDNA ORF Clone, Mouse, N-His tag MG51979-NH
KLHDC2 cDNA ORF Clone, Mouse, C-HA tag MG51979-CY
KLHDC2 cDNA ORF Clone, Mouse, N-HA tag MG51979-NY
KLHDC2 cDNA ORF Clone, Mouse, C-Myc tag MG51979-CM
KLHDC2 cDNA ORF Clone, Mouse, N-Myc tag MG51979-NM
KLHDC2 qPCR Primer Pairs, Mouse MP201852

KLHDC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KLHDC2 cDNA ORF Clone in Cloning Vector, Human HG14191-G
KLHDC2 cDNA ORF Clone, Human, untagged HG14191-UT
KLHDC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14191-ACG
KLHDC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14191-ACGLN
KLHDC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14191-ANG
KLHDC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14191-ACR
KLHDC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14191-ANR
KLHDC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14191-CF
KLHDC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14191-NF
KLHDC2 cDNA ORF Clone, Human, C-His tag HG14191-CH
KLHDC2 cDNA ORF Clone, Human, N-His tag HG14191-NH
KLHDC2 cDNA ORF Clone, Human, N-HA tag HG14191-NY
KLHDC2 cDNA ORF Clone, Human, C-Myc tag HG14191-CM
KLHDC2 cDNA ORF Clone, Human, N-Myc tag HG14191-NM
KLHDC2 qPCR Primer Pairs, Human HP102842
info info
添加购物车成功! 添加购物车失败!