KLF9 cDNA ORF Clone, Human, untagged

Cat: HG15361-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KLF9 Reagents
CRO Services
Product recommended

All KLF9 Reagents
KLF9 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human Kruppel-like factor 9.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLF9 cDNA ORF Clone, Human, untagged Alternative Names
BTEB cDNA ORF Clone, Human;BTEB1 cDNA ORF Clone, Human
KLF9 Background Information
Full Name
Kruppel-like factor 9

KLF9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KLF9 cDNA ORF Clone in Cloning Vector, Mouse MG58815-U
KLF9 cDNA ORF Clone, Mouse, untagged MG58815-UT
KLF9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58815-ACG
KLF9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58815-ACGLN
KLF9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58815-ANG
KLF9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58815-ACR
KLF9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58815-ANR
KLF9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58815-CF
KLF9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58815-NF
KLF9 cDNA ORF Clone, Mouse, C-His tag MG58815-CH
KLF9 cDNA ORF Clone, Mouse, N-His tag MG58815-NH
KLF9 cDNA ORF Clone, Mouse, C-HA tag MG58815-CY
KLF9 cDNA ORF Clone, Mouse, N-HA tag MG58815-NY
KLF9 cDNA ORF Clone, Mouse, C-Myc tag MG58815-CM
KLF9 cDNA ORF Clone, Mouse, N-Myc tag MG58815-NM

KLF9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KLF9 cDNA ORF Clone in Cloning Vector, Human HG15361-G
KLF9 cDNA ORF Clone, Human, C-GFPSpark® tag HG15361-ACG
KLF9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15361-ACGLN
KLF9 cDNA ORF Clone, Human, N-GFPSpark® tag HG15361-ANG
KLF9 cDNA ORF Clone, Human, C-OFPSpark® tag HG15361-ACR
KLF9 cDNA ORF Clone, Human, N-OFPSpark® tag HG15361-ANR
KLF9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15361-CF
KLF9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15361-NF
KLF9 cDNA ORF Clone, Human, C-His tag HG15361-CH
KLF9 cDNA ORF Clone, Human, N-His tag HG15361-NH
KLF9 cDNA ORF Clone, Human, C-HA tag HG15361-CY
KLF9 cDNA ORF Clone, Human, N-HA tag HG15361-NY
KLF9 cDNA ORF Clone, Human, C-Myc tag HG15361-CM
KLF9 cDNA ORF Clone, Human, N-Myc tag HG15361-NM
KLF9 qPCR Primer Pairs, Human HP103985
info info
添加购物车成功! 添加购物车失败!